Description :
From Genome Similarity Track
Location :
Scaffold_5:103875- 105457
Transcript NameFunction/comments
g2745.t1hypothetical protein

Sequence
1582 bases(100 bases per row)
CCAGAGGAAGGCAAGGGAGAGCAGACAGCAGGCGTCAAACGTCACCAAGATCCGACCGAAACAGAAGAAGAACTGGTTACGGAAAGCACGCCGAAACGAC
GCTGGAAGGAGAGTGGAGAAACAACGGAAGACAAGGAAATACCTGGAGTGCTGGAAGAAGAAGAAGAAACTAAGCAAGACAACCAAGAGGACGAGGACAT
GAAGCACCATGATCAGCCAACGTACGAAGAGATTGAAGAGGAGCCTCTAACGTTCGCGGAGATGTATATCTACCTGCACGGAGAACTAGCAGGCAAGGGG
ATTGAAGAAACAAAAGACACCGTCAGTGCGCTGGAATATATGAAGAACATGCTCACTACAGTCTTCAGAACGCACCCTGACCTGACGTTAACGGAGAACA
AGCGCAGATACCCGACTCTGACCGACGATGAAAAAGAACAACTACTGAACTTGTTCTTGGTGGACGCGGCCATTGGTCGACCACACGCGAGAAAATGGAG
AGAGCGCCTGTATGATATCACGCGATCACTGTACAAAACACGTCGCATGATGACTGAAATAGTCGACCACAGAGTCGGACTCCAAGGCATCCACAGCCCC
AGTAGTCAACGCCTAGGCCCAACAACACGACCAACTAGCTCCCCAGAAGGAACCGGACACAGATAGCGACATGACGGGCGATGAAAGCTCGTCGTACCGA
TTCATGACCACTGCATTTCCAGCATCTGAAATTCCTGTATATTGTCAAATTTGTGAAACTCCTTACGGATTTCCTAGCAAAATCCGCAAGCCAACAGAAA
AAGAAGAAATCATCATCAGAGGACTGCTGGAGGGGACCATTCTCTGTGCCCACCTGCCACCATTCCTCAAGCGCATATGCACTAATGCGGCTCTTCGGAT
GATCCAGAACACAATCCAAGCCCAAGTGGAAGGAGACTTAGCCATTCATCTACCGGTGGATTTCCCAGTGTACCATGACTTCCAAACGAGAGCAAGACTA
GTAGGCATGATCCTACTAGGGAAACGCAGAAGTGAACACCCAGAGTAGCGACTCGTAGCATTCCTGAAAAGCGCAAAACAAGTCTGTTATGACCGTAACC
AGCATGCGATCCATTTGATTTTCTGCACACGAGAGCAAGCAGCCATGTGTGGGAAAGAATTCAAGTCTCAACCATTCCGCCACAAGAACTTCGCCCTGCT
AAATGAAAATGAGAACGCCGGGGAACCAACTACCACTATAGGTCATAGCTCCACGACAGTCTGGGCCAGACAAATGGGAGCAGATGGAGTACGGGACGAG
AAATCCCGAGACAGGTACCATGTCCGACTACTCAACTTGTCAAGATTTATGGATGAAGCAGCCCACGACGCATATTAACAGCAGAACTTCAAGGGCAACT
ACATGACCTGGCAAGAACCATCAGCAGGATCTTATGAGAGACAAACGGACACTTGGGACGTCTACTTCAGAAGCCCGCTATGCCCGCCTAGTAACCCAGA
GATTCCTTAACTGGAACGGGACCAAGATTTTGATCCACCATGTGAATGTCAAACCAGCACCACCATGCTTCCAATGTGGGGC