Description :
From Genome Similarity Track
Location :
Scaffold_159:103839- 107608
Sequence
3769 bases(100 bases per row)
TTTCAACACTCCTCCTCGCCGACACTGCATCCTGTTGGTGTGTTCCCAGTTCTTAATGCAATCCCACCTGAGCTCGCAGCTCATCAAGTCAAGGGGCCGG
CAACGCCTTCGTTAGGATGTCCGCAGGCATCCTCTTGCTCTCTCGATACTCCGGTCCCAGTACGCCTTCCTTGGTGAAATGTCCAACGAACTTGATCCGT
ACGTCCACATGTTTCGCCTTCGATGAAGCACCCTCACCTTCGAGTTGCTTCAGCGCATCCTGGTTATCTACTCGTAGCGGCATCGGTTCTACGAACGCGA
TCTCCAGCTCCTTAAGCAATTCTCTTACGCCTAGTAGCTCTTGCGCCATGACCGACGCTGCGGTGTATTCCGCTTCCATCGTAGACAAGGACAGACCCGT
CTGCTTCTTGCAGACCCAGCTTATGGGCATCCCGTCTACTGTGACGAGCCCACCGGTGACCGACTTCCTGTCGCCCTTATCAGCCGCAAAGCCCGCGTCA
CTATAGCCCACAACTTCCAGTGGCTCCATCCGCCCTCTGTCTCCTTTCATCCGCAGCCTCAGCTGCTTCGTCCCAGCGAGATACCGCAGTACTCGCTTCG
CCAACTTCCAGTCCGTGACCGTGGGTTCATGCGTTCGCCGCGACGCCTTGTGAACAGCAAAAGCTATATCTGGCCTTGTGCAGCGAGCTACCCAGAGTAG
GCTGCCCACCAACGACTGGAGCTTCTTCACTGTCGCAACCGCGGACGCACCGGAGATCGGCGATTTCTCTAGTTCGATGTCGCATCCATCACTCCATTCT
AGTCCAATCGGCATCCGCTCTCCGTGCGCCATACCCATGCCGAACTCATTCAGCATCTCTGTGATCGTGATTTCTTGGTCGAGATCGTACCCATACGACT
CATCGTACACGACTCTCATCCCGAGAAACTTCCTGGTCTCTCCCAAATTCTTGATTGATAAGTCGGCAAGTTCCCCAAAGAACGCATCCACGGCCTCCTG
TCCCGTTCCGGTCACTAGTAGGTCATCAACATATACGCCGACTACCAGCACTTCGCGCCCGTGTCGTCTGTAGTAGACACACATGTCAGTCAGGCTTTGT
ATGAAACCAATCTCTTTTAGCTTGCGATGCAGGAGCTCGCTCCAGAGTCGCCCAGATTGTTTCAAACCGTAAAGCGCTTTCTTCAGCTCGAGTACCACCT
CGTCTCCATGACTAACACCCAGTGACCTCTTCATCTCGTCCGAGATCTCCATTCCCTTGGGAATCTTCATGTAAATGTCCAAATCAGCCTCTTTATCAGC
TTTAACGTACGCGTTGGGGACGTCGCCATGTTTGGCAGGCACGCCCCACTTTCTGGCCAACACGAGAATCAACTTAACGCTGCTCATGTCCATCACCGCA
GCAAACGTAACACTATAATTGACGCCAAAGATCCGTTCGTTTCCACACGCCACTAAGCGAGCCTTCAGCCGCTCAAGCGCACCTTCCGCATCCAGTTTAG
TCTTGAATACCCATTTTCCGTGCAATGCGTGTGCTCCACGCGGGAGCTTCACCACCTTCCACACACCATTCTGTTCGAGAGCTTGCAGCTCCTCCGCGAT
GGCCCTCAGCCACCGCGACCGGTGTCAACTCTTCATTGCCTCTCGGTAGTTCCTTGGGTCCGGCTGCACTAAACTGTTCACCACGTCGGGCGGAGTCTCC
TCCTGACCTCCCAGGTCTGGGCCGACTCCTCCTGACCGTTGAACTACGGACCGCGTAACTGGGCGATCCCTAGTCCAGTTCTTCTTCTTCCTTTTGAAGC
GCTTCTTAGTGCTCCCACTCGCATTCCCTGCCTCGGCAGGTGCCACACCGCCCTCGGGCGTCTTCTTAGCAGCTTCCGACTCCTCCTGAGGTCCGTCCTC
GTCGTCCTGCAGGTACAGCCGCTACACTTTCTCGCTCTGCTCTTTGTCGAGCGTCTCTATGTTCTTCACGTGTTGCGTCACGATCACGACTTTGTCCTTT
GGCAAGTAAACTCTGTAGCCCTTTGTTTCCTCTCCGATTCCGACAATCATGCCTGCCTGCGCTCTCTGTGCAAATTTTTGTTTCCGCGGGTCCCTGTAAA
CAGTACATGTGGACCCGAAAACAACTATCTCCCCTAGCTGCGGCGTCTGCTTCGTCAGTACTTTAATCGGTGACGCACGCCCTGGGTTGGAGCTGGTTGG
GGACCGGTTCAAAATGTACGCCGCGTATCTAACAGCATCTCCTCAGAAACTGAGAGGAAGCCCGCAGGCAAACCCCATGCACCTGGCCATATTCATAATG
GTCCGGTGCATCCTCTCAGCCTTTCTGTTGCTTGCTTGGTTTCGCGCCTCGCTGCGCTGTCGTGCGACACCAGCTCTCTTGCAAAACAAATCTACGTTTT
CGTACTCACCTCCGGAATCCGTTCGTAAGACATGAATCCGGCAGTCGAACCGTTTCTCGAAGTAGACGAGGAACTCTTCGAACTTTCTTGCCGCTACATC
CTTCGTCTTGGCAAGAAACACCCCACAATAGTTCGACTTGTGGTCGACAAAGTTTATCATATATCTGTTACCCAGCCGATCTTTCGGGGTCATGGGTCCT
TTAAGGTCGGAACAAATCACGCCTCCTACACGATCTGTGGGAGCATGCTCACCAGAGTCCTTGCTCGATTGTCTGTTCTTCGTCTGCTTGCCCTCGGCAC
AAGTCAGACAGTTCACTCTCCGTCGATCGGTCAGTTCGATGCCGGAGCTTGGCTCGCGTGCCAGCCGCTCCACGGCATCATAGTTCAGGTGCCCGAGACG
TCGATGAAACTCGACCAGCGTGCCCTTCTGCACATTGCTCGTCTCGCCGTCGGTCGCCGCCACCACCTCAGTGAGCGCGGCCATGATCACGTCTGACGCG
AGTTCGCGCTTCTTCTTTACCGATCCGCACACCATCAGCACGTTCCTTCGTAGCTCAACGTCAAAAGCCACATGCTGTCCATTCTTAGCGGCCACGACGC
GTCGTCCATTCTTATAGGTCAGTGTGAAACCTTTTTCGTCTAATTTTCCGTACGATATCAAATTATGTACGACGCCCTCGGCGTAGTACACGTCCGTAAG
CTTGAGTGTCTGCTCGGCACCGCATGCCGAGACTCTGAGTGTCAGTGTGCCCTTCTTTCTTATGCGCAACGGCTCACCGTTGGGCTGCACACACACGTCC
TCGCACTCCTCCACTTCGTCCAGCCAGGACTCGTCACTGACTAGATGTCTACTAGATCCACTGTCCAGGATCCACATTTCCTCGGTCGCAACCGTGTCTT
CCTTTACGGCAAGGGTCAAATCCGGTTCCCCGTCGCCTCCTCGCCCACGCTCCGGACACGCTGCACGCAGATGCCCAACTCGGCCACACTCGTGGCATTT
ACGCGTTTCTCTACCACGCGCCTCGCCAACTGCTCCCACCAGCTCTTTTCCAAGACTCCGGTGCCTTACCGGATCTAACTCCCAGGCCTGCGCGAAGTGA
GCCAGTTCTTCGGCCTGCTGCAGATAGTCCGTCCTGCTCGCGTCGACCTTGGCCATTAGTACCATCCGTAACTCAGGAGACGCGTACTGCACTATATTAT
TAAGTGCAAGATAGTCAGCTCCGCCGCCGCACGCTTCGGAGATGGCTACGAGGTACATATAGTGCTCCGACCAGTTGCGTTTAGCGTCCTTTGGTGCAGT
GAAGAGCTTCATCGCCTGCGCAGGCGTGATATTCGTCTTAAATGCTTCCAGCATACGTTCCATAACGTG