Description :
From Genome Similarity Track
Location :
Scaffold_5:103837- 105565
Sequence
1728 bases(100 bases per row)
GACGGATCTCATCTTCGCTCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTC
ACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCGAACCAGTATATTAAACAAGCTGGCAGCG
TGATCTTGACCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAATTTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACG
AGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAAC
CACTTTCCTGGGGCACAGTACTTCCAGTATCCACGGGACCCCCCTGTCAGCCGGTCCATGGATCCAACATCTACAGATCTTCGGGATCCAGTAACCTGAC
AAACCTTGGGTGGATCTGCAGCGACCTCACCCTTGGTAGGCCCAAACCATTGACCATGCTGTCGTTTCTCCCAGTAACCGCGCAACTCTCCCCTTTGTAG
ATCCAGGGTTGAAGAGACTTCGGATTTGGCAAACTCATCCACTTGGCGCAAACTAGAAATCTTGGCAACTGACACTTCATGTAGATTACGTGTATTATCG
ACTGGATCTAGGGTCCTGCTACCTGGACCTAGCGATGTCTTGCTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCG
GCGAGCGTCCTAGTTTAACATCCTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCACTGGCGGATCTGGTTGTAGAATTCTTCC
ATCGGACACTTGCCGACGTCGTGAATCTCGCCACAACCGCGACACACGTAGAAGCAATGATCTCCGCGATGACCTTTCTTGCCACACTTCTCACAGACCA
GGTGTTTCCAGCATCCAGATTCTGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCC
ACGGTCCCCGGGTACGGTATCCGCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACCCGACGGTAATCTTCAGGGT
CGGAGTCCGAACCGTCGGATCCTGATTCAGTTTCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCG
ATACTTGCCGGATCCTACCGCCGCCTGCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCGGCACTTCTTCAAGTTCATCAGCGTCTGGAGGACGTAAC
AGGGTCAGTCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCGCAGTACCTTGAATCCCCCATCCTTGATCTTCAACTT
GGCCCGTAGACCGGGCCACATTTAGTCGATGTAGGTATTATAGCGAGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCT
CAATCCACAGTACTGTGTCTGGAAACTGCGCAGATAATCTGCCCACTTTGTTCCTGGTGATCTGCCCAGCTGCCGATAACAGTTCCTTGTCTGGCCCCGC
TAGCAGATCCGCAAAGGTCAAACACTTT