Description :
From Genome Similarity Track
Location :
Scaffold_82:103833- 104844
Sequence
1011 bases(100 bases per row)
GTGAGCAGGTGCGCGGGGCAGCGCAGGTTGGGGAATGAGCTTAGGCCCGCCACACCGGATCCGCAGTGTTTGTGTCCGACAGCCCATGGGCACGCCCACA
CGTTGCAGTCGCAGCAGCCACAACGCACGTATCTACGCTGATACGAAGCCATGAGACTTTGAGACTGTCGGCCGGAGCCCGATGCGACGTTATCGTGGAC
TCGTGGTGGACGACCCATGGTGTTAAACTCGGTCCGGCCAATCACACGCACGCTCGGAGACTCATTTGAACAAATAATGGGCCAAGTTGAAGGCGCGCGC
GTCTCTTATTCGCCATTAATCGCGCGCCGCTTCAATACTGAAGATTTGCACTGACGACACCTTCAACTTCAGAAAAGCGGTTTGGAGCTGCGCCCAAGTG
CAAGTGGCGCATGAACGCCATGCTCTGAATGCAAAACTTACAGGCGAGCGGCACTGGAGCGCTGAAAACGCCACGGCCTCTTGGTCAGCCCTGCATGCTC
ATGCCACCGGGCGGGAGCTCGCCGACGAATAGGAGCTTATCGGGACTCGTTGTCGCACCCGAAAGGAAAATGATGGCTGCCCATTACGGTGCATGCACCA
TGTCATGTACCCTCGCTTGTCGCTGGTGGACTGGACCAGCTCAGCGGTGTCACCGCCACCAAAAGCCCGTTACGCGAGCGCGCATGACAGCCCAACACGA
TGTCCGGCGTCCGCCGCAGGATCATTGTGAGCCAGCTCCACACGCCTTCAACGCGGTGTTGTCGGTGTTGAAGTTCGGGGAGCGCCAAACGACGAAGCAA
CAATTGACACCGGCATAGAAGAGCCCCGAATCTCGCTGGGAGAACACATCGAGAGTGCTCGATCATGATCGTCGCGTGGGGAGAGACGATCTGTGTTCGA
AGGGCAGCAGCACAAGGTTGGCTTCTTTCTGATCCATTTTGGATCTTGGCGGTCGTCGTAGAGACTGTAATAGTGCTGCCACTGTCGGCCGAGCAATCGG
CACCCCGAATC