Description :
From Genome Similarity Track
Location :
Scaffold_783:10382- 11404
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_783-snap-gene-0.926S proteasome non-ATPase regulatory subunit 7

Sequence
1022 bases(100 bases per row)
TCGAGCGCCGCGGCCAAaTGGAAGCTGCCGGAGGAGGTGGTGACGCACCCGCTGGTGCTGCTCAGCATCGTGGACCACTACAACCGAGTGGCCAAGGACA
CGAGCAAGCGCGTCGTCGGCGTGCTGCTCGGCTCGACGTTCCAGGGCAAATGTGATATCACCAACTCGTTCGCCGTGCCGTTCGATGAAGACCTGCGCAA
CCCAGGGATCTGGTATCTTGACCACGACTACCTTGAGAGCATGTTCAACATGTTCAAGAAGATCAACGGTACGTGGCTGTTGAGGGTTATtGCTGTGCTG
GGGAATGAAGGAGTGGAGGTGATGACGCGGGCCCGCTGTGTGAATGAACAGCCAAGGAACGTATCGTGGGCTTTTACAGCACGGGTCCAAAGATCCGCAA
GGCCGATCTCGAGATTGACGAGCTGTTCCGCCGCTACTGCCCGAACCCAGTGTTTGTGATCTGTGACGTGCGCGCGAACGTAGAGGGCCTGCCGACAACC
GCGTATGGATCGATTGAGGAAGTCGAAGAGGATGGCAAGGCCATTAAGCGCACGTTCAAGCACATCAAGTCGAGCATCGGCGCCTACGAGGCTGAAGAAG
TTGGCGTTGAGCACTTGCTGCGTGATATCAATGACCCATCCGTGAGCTCTCTtGCCGGCCAGGTCAAGCACAAGATGACAGCGCTTGCTGGCCTGAAGgA
GCGTCTCGAGGAAATGAAGGTGTACCTCGAGAATGTTCTTGCGGGCAAGCTGCCCGCGAATCACCAGATCGTGTACAACATGCAGACAATTTTTAACCtG
CTGCCCAACTTGAACGTTGACTCACTCGTCCGATCAATGTTCGTCAAGACGAACGACATGCACTTTGTACGTGTTTAGATAGCGTTGGATGTGTACGTGG
ACAGGGTGATGTACTTATGGGGTGGAGTATTGCGCAGGTGATTTATCTGTCGTCGCTGATCCgCTGCACTATTGCGCTGCACAACCTGGTAAATAACAAG
ATCAAATACCAGGAGCTGGAAG