Description :
From Genome Similarity Track
Location :
scaffold_610:10381- 15128
Transcript NameFunction/comments
Pl_103465hypothetical protein PHYSODRAFT_507700
Pl_103467hypothetical protein PHYSODRAFT_545979

Sequence
4747 bases(100 bases per row)
CCCAAGTTGGCTCCTGTACCCTCGCCAAGGTCTGGAGGAGCACTAGGAACTGGTGCTCTTACAGCTAAACCACCGGCACCTCATCCGTTCCGACTGTCGG
ACTTCTTCTACAAGGAGATCTTTGGAGTTCATGACATTAAGCAGAGTGATGGCGTGCATCAGGAACGTGTGCAGAACTTCTTCGTAGTGCCGTTGAACAC
GGAGCAGTTGTTCCTGTTTGGTGTACTGCTTGCACTCGACAGTTTTCTCTACGTGTTCACGTACCTGCCGCTGAGGATTTTATTTGCATGTGGCTGTGCT
GTGACGTCGAGTTTTCATACACGGGTGTTTCGAAGGACGCACTTTTATGATTTGATGGTTGCGGTGATTATGGCGGTGGGGACGACAGTGTTGGGGCATG
TTGATATGTCGAGAGTTTACCACGCGATTCGAGGTCAAGCGATGATCAAGCTCTATGTGCTGTTTACGATGATTGAGATCTTTGATCGACTGTTCTCTTC
GCTTGGACAAGATGTGCTGGACTCGCTATATTATACAGCAAAATATCACCCGCGTCGCGTCACCCGTATGTTCCTGGACTTCGCTGTAGCTATCATCTAC
GTGGTGCTACACTCGCTTTTGCTGTTCGCGCAAGTCGTGACGCTGAATGTCGCAGTCAATTCAAGTAATACGTCGCTGCTCACGTTGCTGATTTCTAACA
ACTTTGCTGAGCTCAAAAGCTCGGTGTTCAAGAAATTCGAGGAACAAAACCTTTTCCAGATCAGCTGCAGCGATATCGTCGAGCGCTTCAAACTTCTCAC
CATTATTGGACTTATCATGCTTCAGTCATCTGCTGGGGATGTTGCCTGGGGAACGGTACGATTGTTCATGTTTTTTCCTCTTAGGCTGTATCCTCACTTT
TGTGTATTGTGTAGGCCATGGTTTGGGTAGCTGAAATGCTGATTGACTGGCTCAAGCACGCCTTTATCACCAAGTTCAATCAACTTCCGCCGACCATGTA
CTCCAAATTCATCACCATCCTTTGCCGTGATCTGACAGGATGGAAGAGTGAAGATACCATTCTGGATCACACGCACCACGTATCCAAGCGGCTAGGACTC
ATGTCATTGCCTTTAGCCTGTGTTGTACTGCGCATGGTATCGAAGGCATTGACTGATGTCCCGATTGAGTTCGCATCGCCTAGCGGTATACTTGTGTCTG
TGGCGTTTTTCCTCTGTTTGGCGGCGTTCAAGGCGCTGTTGAGTTTGGGCTTGATGATTTACGCCTGCAAGTCCGGTCGGTTGGATGACACACGCCCCAA
GAGCCCACGGTCTGTGCGCCACCTCGAGTCGATCCACCGCTACAAATTCTAAGAGCTGACGAATTGATGATTGATAGACGCTTACATCCTTCAAAAGCTT
CTTCGTTCATTGTGTTATGGTCATTTCCTATCGCTTATGAGATGGGTGAGCGGCAGATCAAGCCATCTTCGCCACGGTCTTCGTCTTCAACTCGGCGATG
GAGTGGCGGCTTACTGATACAGCATATTGTCGTGTCACTTGCTTCGCCTTCACGTCCACTCCACCTAGGCTACTGCGCTCGATTGCCGCTCGCCATCACC
GCTGTTATGGGCTCTTCATCGTCCTTGTTCTTTGCTTTGATACAAGTCCTAAACATGCATTCCTCTTTTTGTATCTGTCTTATCTACAAACGCGCAAAAC
TTTTGGATCCTTTCCTGCTTCTTGTCACTAGTTTTCCCTCCTCGCCTTGTCATCATACCCATGCGTCCTCCTCGCTGGTGGCAGGTTCATCCATCATACC
TGCTGCGCGTCTCCAGCTATAACGGATTTCCTCGCTTCCTAGTCGTTCATACACCACACGCTCTTTCCCTAACTGCTGGTTCATAGTTTCTCATCTCACC
ACCGGTCGGCAGGGCCTTCCCCTCTTATGCACGGCTCGTTGCATTCATGCCCATGCCGCCAACATCATTCATCATCATCATACTGCCGTCATTACTATGC
ATTTGTGGCATGCGGTTACTGCGGCCACCTCCTTGGAAGTGATGCGTCGCACCCATGTGATTGCCTTGCATTTGGTACATTTGGTTCGGCTGCAAGTGTT
GTTGCATGTAGCCGCCTCCCATAGAAGAAGCCGGCAAATGGCTCATCATCATACCATTTGCACCATTGTCGAACAGGTTGTCAGCAGTCGGCGACATTCC
CATATCCATGCTGATGTCCATGTTCGGGAAGCGCTTGAGAATACGCGCTGTGATGCGACGACCGCCCGACGTGTTCTTCATGGCTGCAAGGTGCGGACGG
ATAGCCTTCACGAGTAGCAGGCACTGCTCCTCGGCACAAACACACAGCGCGCGCTGCACAACGTAGTTAGCAAACTGGTCCTGCAACATCTTGTTCATCT
TGGGACAGCTCGTGATCTCAGCAATGTACTTTTGGCGCACACGCTCGGGGGCCTTCTCGAGGCACTTCTCGATCACATTCGAGCTAAACTTTTGTACAGA
AAGCTCGTAGATGTGGCCCAGCGGCTTCATAATGACACCAAAGGCCTCTTCGGCCGTACATGAATCAAGCACATACTGCACGACATAGTTGCCATACGGG
TCCTGCATCAGCTTCATCGCCTGACGCTCCACTTGTTCAATCACCTCTGCTTTCTGCGCCTTGTTAGCTGCGTCCAGGCAACGTTGCAGGACACAGCATC
CATGGCGGTGCGTTCCAACAGTTGTGCACTCCTTACACACAGCATCAAATACAAACTGGTTGTACTCGGGCTTCATAAACTGCAGAGCACGTTGGATCAC
GTGGTTACCGTTCGAGTCAATGCACAGACGCACAGCATCGTCTTTGAGCGCCTCAACAATGATATCAGGCAGGCTAGTCCGGCGTTTCTCACCACCTTCG
GGACGTTCTTCGTGATCCTTCACATAGCCATAGTCATCTCCATCTTCCTCTTCATAGTTTTCCTCAATAACGTCAGGCGACGTTGCGCACACCTCCACCA
CCTTCTGTACCGACCTCGTACCGTGCAGGTTAAGAGCAGCAGCCACAAGGTTGGAACTCACACGGCGGATAATTACGAGTCGTTGCTTCTCGTTCACACG
CTCCAATAGCTTCTGGAAGAGGTAATTCCCGAAAGGGTCAACCATCATCTCCGCAAGATGCTCAAGCGATTCTTGGTAGATCACCTCACACAAATCCGCA
CGGTCTTCGTAGTCGAGCTGCTCCTGTAGTAGACGGCAACCATTCTGGTCCTTCGACATGGCGAACACACGGTTTTGAATGTCTTCCACACTCAACGCAG
CACTCAAACTCGACGGATCATTGGCAGACCCACCCATCATCGGTGCGCTCATACCACCACCATTCATCAAACCCAAACCCATGCCACTGACACCAGAGTT
CTCCGAACGATAACCCATACGAGATTGCTGGCGCCCTCCAAATGCTCCATTCAATTGGTGAAGATCGTCTCCACTCATTTGATGGCGTTGTTGCTGCATC
AAGTGGGACGGTGGTGGTGACATCATCATCCGGCTTTGCTGGTACATCATCGAAGCACTCTGACGGTTTGAGCTGTGACCGCCACCCATGTGCTCCGGGG
TCGGAGCGCCAGCTTGATGCACAAACTTACACTTGCTGCCCATACGACAATGGCCTTGCAGGAAAAATTTGCATTGTTTCATACCCATCTGCATGCCCAT
GCCCTTGCGAGGTGAATGAGGAGGAGACGACTCCGGGAGTGGCGGTGTCATGCGCGAATACATGTTGCGTCCTTGTCCACGACTACTTGTGTGGCCTCCA
CCACGCATTCCCATTGGAACCTGTTGCTGCGAAGTGTATCCCATTTGGGCGTGGGGGTGCCTCATCGGACTCGAGCGCGGATTCATGTACATGCTGTTTC
CACCAACATCATACATAGCGGCAGGCGGGTGTGGTCCCACCACCGCTGGGTTCCATTGTCCTGAATTCATCTGCGCACGTGACGGAGTGTTACCATATCC
GTACGACCCATTCGCCGTTTGTGGTGATCGGTAATGCTGCTGTTGTTGCTGACGATACTGCTGCTGCTCGAGAGCGTATGATGCTGCCATTTGGTTGTTT
CCATAGTAGTCGTGCATCTGCTCCTGGTACAATGCATTATTGTCTCCATCTTGGCTTCCCGACCATGACTCTTCCGATGACATTCGTGGACTCAACGTAT
AACCTCCACTATAAGCAGCACTTGGAGCACTGCTAGTACCTGGCACTGTGCTTGACCGTGATAGAGATAGTGAAGTCGGCATATGCGGTTGCTGTATATC
CCGACCACCTCGGTAGCGTTCCTGTTGGGCTGCCGACGTCGGTTGTTGACGATAACGACCTCCCAACGTAGCATATTCGTTCGGAGATTCCTGCACCGGA
TTGAGCTGGAATTGACCCGACGCGTACGAATTGACGTTTCCAGCAGCACTAGATCCAGTCGAGACGCCATTGCCTCGACTAGCAGCTCGCTCATTAGCCT
GTAAACTCATCTGACGGTCATCCAGACTCAGTTTTAGGAAATCTCCACCCAAAGCTTGACTCGGCGACTGCGACAGGAACATCTCAATGCTGTTTTTCCG
TCGACTATTGTGCGACGGCAGCATCTCCATCGGTGGTCGCGTTTTCCGCACTTTAATGTCGATCCTCTCCGTTGAAATATTCTCCTCCTTCGTGTCGTCA
CGTGTCTGGTTCGATGGCGAGAGAGGTCGTGGAGGTAAGACGTCATT