Description :
From Genome Similarity Track
Location :
Scaffold_51:103800- 106429
Sequence
2629 bases(100 bases per row)
TCTCAACTTTCAAGATCCCGTCACATGAGGCGGCAAGTACGACGTAAAGGAACTACAAAGGCAAGGGACACACCCGCAAGGCAGCCCTACGGCCAGATCC
ACGATCTAGGCCCCGGATCCATAAGCTCGAATAATCGCTTAGGATTCGGAACCATCCACGAACGCAGATTGAAGATTTTCCACTGCTGCTCCACCCCATC
CCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAA
AGTTCAGCAGAACACGGATCATCGGGGGGGCCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCCAGCAATCTTGCAGATTTTGCTGAT
CCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTAAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGA
AGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAG
GTGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAA
AACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACATCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACGATAAA
GAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCCCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTC
GAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGG
TGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGA
GGATATCTTCGGGCTAGATCTGGATCTCATAGCATCCGCGACGCAGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGAT
CCAGTGTCATCGCCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTT
TAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGGTCCGAAGACAGGAAGCCCCTGTGAACGTGAAGGCTCGGGATCCAGTAGGCCCTACGCG
TGATCTGACACAATCCATCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCAGGCTCGAGGTAATCGCCTCACGGACCCTGTC
TCGCCAGTGGACCAGACGGCCGCAGGCTCTTCCGACACGTCCTCGGGCACACTGCAGCGGCATTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGG
GTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAAATGGAGTCAGTGGAGGCAGACAACTTCCATGATGAGTT
CGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATC
TCAGCCATATCGGACCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTTGGCCCTCATGAGAGATC
AAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATTCACCAGGAACAAGTG
GCCGGATTTGCTGCGCAGCTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCG
CTGGAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCACTTCA
TCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGTTACGTCTTCCAGACGCAGATGAACTTGAAGAATTACTGCGGGCTGTGAATCGCGC
GAAACACCGCCATAAGAAGGCGGTGGTCGGATCCGGCAAGTATCGCCAAAAAAACTCCGACGCCCACGGCTCCAGATCGACGTGTCGACCAAGGCACGAC
GCCCGACTCAGGAACTGAATCGGGATCCGACAGTTCGGACTTCAACCCAGAGGATTACCGCCGAGTCTGTCCAACGATCGTGCTGCGAAGACCGAGGACA
ACTCTCGATCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGGGCAAATCAGGTGCTCGCAGTGCGGATC
CCGGAAGCACACAGAATCTGGATGCTGGA