Description :
From Genome Similarity Track
Location :
Scaffold_475:1038- 7269
Sequence
6231 bases(100 bases per row)
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATAAAGCGTTATCAATCAAACGCTGATAAATCTGTGAAGCGT
TCTTCAGTCCAAAAGGCATCTGCAACCATTCAAACAGACCCGAAGGTGTGCTTTTCTCGTTCGGTCGTCTCCACCACCCAAAATCCACTAGCCATGTCCA
ATGAACAATACCACACTGCCTTATCCATATCTTGCAACGATTCGCTAATAAGAGGCATGAGATAAACCATCAACCATGTTAGCTAATTCACTCGTCGATA
TTCAATACATAGTCGGATATCTTCCTCATTCATCTTAATAATCACGACTATTGGTGACGCCCACGGTGATGTCGAAGGTCGAATAATCTTAGCTGATAAC
AGGCCTTTTATCAGATCAGCCAATTTGCTCACGAATTTCGGCGCAACTGGTCGGACGCGCTGAGCTATCGGCCTTGCCTCTCCAACATCAATATCACAAA
CGTCCCCCGTGCTTCAGGGGGTAATGCATTGCCTTTTCCAATCAACAGGTGACGACTCTTCTATATCAGTTGTCGCAAATCATCTTGATCTTCTGATAAC
AGTACCCCATGATCGCCAACCTGGCCATCGTCTATCCTTATCTCTGTCGTAGATTCCGTCACCTCCGGTAGCACATCCATATGCTGCTCCACATCTTTCG
GGAACAGTCCACCTCCTTCGTGGTAATATATTGATTCAGCCGGTATATCTTCTTTCATCATTTCCTCGTCAATCGCAGTGGCTTCCGCGCTGTCGACCAA
TCGTGTGGACCTGACATGCACTTCTCAATCCTCTACCTTGATCTCATCTGGCTGACAGTTGGACTGTCCTTGTAGCGGATCACTTGTCACATGGTCGACA
TCCTGTGTTATGTCCCTCTTTACAACCCTGTCTACTTCACTCGATCGTTCTAGGGTCTTCCGCACTGCGTTGGCCGCGTACGATCTCTTTGAAGATCTAC
CATCCTTGCCTTCATTAATATTTCCACCCGTATACTCGCCTTGAATCTCATGATTGATGTTACAATCAGGTTTAGATCGCGATGTGATCCCCGCAGAAAC
CATGACGTCTTCTAGTTCCTCCTTTGGTCGAATTAAAAGTCGGGTGGGTTTTTCGTACGTAGGATGATCCACTAGCGGTTCCGCATATGCTTCAATCTCT
TCTTTTTATCGATCTGTAGTAGCTTCAAAGGCCGACGTTTGTCATTCCTTATACCGCCGCTATCCGACAGATCCCTGAGACCGCGGTGTCATGTCTCTGT
AATCCACAACGCTAAGGGGGTCCGTAATTTAAGCTCAAGTCGCGATCGCGTATATTCGTAAGCTGCAAGAACTTAACCATTCCGGGCCTATTCGTCACGG
TCGGAACCCACGCCACATCTCGTCTCACCCAAAGCTTGGACTTGGGAGGATTGACGCAGATCCTGACTTCAGTCGATCTACCGGCAGGGATGACAATATG
TTGATATTTAAGGTTGATCGCCAATATATTAGATCGGTACGGCAGTCTCCGCCCAGCCAAACAGATGCGAACTTTTTCTGGTAGACACAGGGTTTTGTCG
GCCAAATCCAAACGGATGCCTGCCGGAACCATGAAGTCCATACCTAGTATGGCTTCTTGACCAACTTGATCACCAACCCAGACATCAAAATAGTATACTA
GTGATACGTCCAGTGGGATTTTAATCTTAGTACACCCCACCTTCATATATGCACTCTCCCCGATCCCAACACATTCTTGCGTTCGGCTCTCGTCGATCAC
ACATCCTACCTTACGAGCAAAGATTGTGTCGATGATCAAGATTTCCGCACCAGAGTTAAACAGCATAGTGGCCTTCTAATTGTTGATCTTTCCCACTGGT
TCGCTTGTTTGAACCAATTTCCGGGGTATGGTATTTCCAGTGTTCCCTTGACTTCCCTGGGGCGACATCGAGCTTCATCTTGAGCGGGGGTCGAGCACTA
TCGTCCACTCGTTTCACACTTGATATAGAAGAAACAAATGTAGAACGATCGCATATATTAGTGATCGGATCGCGCCGTTCCTTAACTCCTTGATCCTCCA
ATCGTTTTTCAACAAATGCATGTTTGCATAGCCTAAAACGTTGGCTCGTGCCAGATTCCAACCTGGCGAGCGTCCTGGTTTAACATCTCCTCGACCTTCG
GAGAAAACATCCCAGCATGTTTGGTAGGCACGTACCACTTGCAGATCAAGTTATAGAACTCTTCCATAGGGCACTTCTCATTCTCATGCATCTCTCCACA
AGCTGCAAACACATAAAAACATTTGTCCGATGGATGTTGCTTGCCGCATTTCTGGCACGTCAGTCTCTGCCAGAATCCACTATCGTCGTGTCTCTTCAAT
ACACAATGAGTGTAGGCTTTCTTAAACGCAACGCGACCCGGAATATAGCCTTGACAATTCTCGTCGGTTGTAGCCCGTTGATCTCCGAACTTCGTCGGCG
GTCCGAGGTCGTAGCCACAAACCTATTACGTGGTTCAAGTTCCGCGTCCGATCCGCTAAAGTCGGATTCCAAAGAACTGTCCGCATCCTCCACGTGAATG
GGCCTCATGGCACGCGCTGGTTTAGCCGGTTTTGGAGAAGCTGTGGGTGCAGATTGTGTTTGACTTTATTCGATCCCATGAGTGATCGAGTTTGTCGATA
TTCCATGTGCTAGTGAGAGCGTAAGGTACCCTCCATATGATCCACATCACCGATTCGTAACAGCGTCAGTTGCTTGTTCTGATCGCGATCATACATGGTC
CCAATAAAGTGTTCCACGTGTTCACGACGAATGTCTGGGAATCCATCTCGAATTCTCATCTTTGCTCGATTCGCTGCCACATTTAACCGATACAGGTAAT
CCAGCGGCAGCTCCTCCGGTCGCTTCTTGGCAAGATAATATTGTCTCCCAGCGGACATACCATAACCACCATATTGCACGAGAAAGTTTTCCACCAGGTC
CTTCCACAAATGACAAGTGGATCGGCTCATCTGACTGTGCCAATTTCTCGCCGGACCCGTAAGCAGATCTCCAAATACTAAGCACTTCTACACATCTGGG
GCTTGATCATGTAGAAATGAAAACGCAGACTTAACCTTGCCGATCCAGCTCCTGGATCTATCCTCTTCTTTGTCCTTCCCATTGAACTCTTCCAGTTTTG
CGATTGCAGACATCCAAATCCGCGGAGCGCTAAGTCCACCATCTAGCACTTTCTCCGCAGTAGCTACAAGTGGTCGTCTCGACTCGACTTGCCCTCAGTT
GTTGGGATCTCCTGCTCCACGATATTGCATTTTAGCGCCACCGTGATGCGATCCAACCGATTCCATCTCATAACATCAGGGGTGTAAAACTCGATATCCG
TTGCAACCTTGATCATCTGGCTTGGGTAGATTGATTCGCGGGCCTTATTACAGCGTTCCTGCTGAAATCGTTCTATGGCAGCATCCAAATATGATTGTAG
TTGTCCTTGGGTGGTCGAATCCGCATCTTCTTTAGCGCGTACGGGTGTTGATCGCGGTCCGCTCTCGATCCCTTCCCCACGACCAAGTAGATCAGCCTTC
GTTTCCATGTATTCGCGCAGATTAGCAGCTCCACTTGGGCCTAAAGACATCCGCTGAATGCCGATTGAGTCTTCTAACTCTACTTCAGATTCGGCTGAGG
CATACTGGGAAGATTAATTGTGATATCCTCTCTGAACTTCTGCAGCCGTCGGTTCCACGTGATCGTTCGCCGCAGTCGCTTCCGCGTGATCATCAGATTT
ACGTATGCCCGTCAAAGGGACTAACTTCTCATACAGCGGATGGCACGGGTGTATCAAGCGATCCTGTTCGCAATCCAACAGCTCTCTTGCATCGAATGAT
CCCGCAACGAATACCGCTTCGTTCGGCAGATGTATAATTACATTGATTCCATCCAGTGTATTCGACGCGATCACTGGGGTTGATATAGGGCCTTAAATTG
TTCCAATAATCCTAGGCTTCAGTATCTGGAGCACTGGATCGTCAAGAACTTCTTGAGCGTCCTCCAGTGATACATCTCTGCTATCTGGTCCAGTTGCCAG
CCTTCCATCTTCCCTTCATCTTCTACAAACTTGATTGGTCTGATGGCCCGATCCCGTCACGCGATCGGGGTGATCCGATCCTGGCGCTGTCTTCTTCACT
CGTGCAGTCTTCGACTTCGTCTTTGTTGACGTTGCAGGAGTGACCTTGAGTGGACTTTGTTCGGTTTAACCGAAGGGCTTACACCCAGCGAATCATGCAT
TGCAGCATGATCCACGGTGGTCCTCGAATGGACCTCAGGAGGGGGTTGGTGGTTTCTTCCCAATCGATCGATCGATCTTCCTCTTTTTTTTGTCATCAAA
GCCCCTCCCAAACGTTGTTGATCTGTAGATCCTTCATCTCCACACGTCCGCGACGATCTCTCTTTCGCCGGCGCTTCATTCCCAGGTTCAGTCTTGATCC
TAAAGTCTTCTCCAAGGGACTCAAGGTGAAATCCCGAGTCACCAGAAGATCCGGCCACGCGCACCACTGTGGTGGAGTGGGATTCGTTCATTTTATGAGG
CGATCCCAACTCTCCACAGGCGCCCAGACGACCGACTAACGGAGGGGGTACTCCTATTCCGCGTGCTTTGCCCTCCTCACCTTGTGTAACCGTCGGTAGG
GCGGGTTGCACTCTTTTAGGTGGACTCGAGTCGATGCCGAACTTGACCGTGGTTGGGATTGGTGTCGATTGCGTGGAAATCCTCACACGATTGCGTTGGT
TTTCTTCGGTGGGTCTCTGTCTGAGTTGATC