Description :
From Genome Similarity Track
Location :
Scaffold_199:1038- 5308
Transcript NameFunction/comments
Phypl_g5136hypothetical protein

Sequence
4270 bases(100 bases per row)
GCGACGCTCGCGACGGATTCCTGGCCCAGCCTCGTGTAGAGCTTGAACGTGTCGGATGCCCAGCGCCGGTGGAATTGGATCGTGAGGGCGTCCACGCCAG
CTCGGTACATGTTCGTGGCGCCGCCGGATCTCAACGAATGGGCGCTGAATGAGGAGACATCCTCACCGCCACCGGCCGCGGCGCGCCGAATTGCCCTTGT
CACTTGAGCTGCCGTCACGCACTTCGGCCGGCCATTGTGGCCCATGAAGGCGGCCGCGGGTATGGTTGCTGGTAGCGCccctcgcgcttggcgcagcagg
agggTACCGAGGACTGGGCACAGCCTCGGGTGTCCTGATCGCCCCAACATCCGAGACACAGAGGCTCCGCCTTGGTTTGTCTTCAAGCCGCGCAGGCGTA
TGCAGACGGCCGACGCGGCGCAAGGATCCGTCGTGACTGAACCCGATTCGTCGATCGTCGTGATGTCAGCGGCGTGGAGCGCAAACATCCGAAAAGAGGT
GCTGGTCGTTTCCACGATCTCCGAACGGCGCAGGAGAAACAAGAAGGCCAAACACAGAACCCCCCCAGAGAGCTTGGTGCGCGGGGTCCTGTAGGTTGAG
TCTGTCCGCGCAGCGCTCTAGGAGCGCGATCGAGACTGGGGACTTCTAGCATCTTCAGGAGTCGAGACGGCTGACGCTCTTCAGGAGCATGCGGACTTTG
GATGGTCGATCGGGAACTCGAGACCCGTGACCATGAAGAAGTGGCGAATGCCGCACAGGATGGTCTTGATAGTGGAGCTGCGCACACGGGCCTGTGAACC
AAAACCTCTGCTGGCTCCCTCAATGATGAACTCGGAGATCATGGAGACCTTCCGGTCGGTGGGACCGGCGAGGTGCCACGGGATGCCACGAAGGCGTGCC
CAGTCCTTCCAGCGGGTGAAGGCGCGACGGTAGAGCTTGAGCGAGGAGTCGGCGACGGAGTGCTCGCGGAGATGTTGTGCCAAAGGACCTCGAGTTCCGC
TATGCTCGCAGGCGGAGGCGTGTGTGTCCAGCCGGTGGTTGAGGTAGCGAATAGGCTCTCGTGGTTGTCGCTCCCCCAGCGGCGGGATTCCGCGTCTGCC
AACGtgttctcggcgctggggATATGAAAGGCCGAAATGCGGAGGCCGAACTGTTGCTCCCAGAGACTCAGCAGGCGAATGAGGATCTGTGCCCGGGAGT
TCCGGGTGGACATCTTGGACTGCCATGACACCGCAGAAGTATTGTCGATGCGGAAGTGTACGTGCACCGGACGGGCGGAGCTGCATTCTGAGCACTACGA
GGGTCCCCACACGCGTACCGCGAAGACGCAGGCGAGGAGCTCCCTGTAGTTGATGTCAAACTCGTTCGAGCCATTCTGCTGGAAGGCTGTGATTAACCCG
CGCTCGTACTGACGAAACTGGTACGTGAGGGCGAGGCGGTGCTCTGGTATCACCGCGCACACTCCCGCGTCGGAAGCGTCTGTGACCACCGTGATGTTCG
GTTCAGGGAGCGCGCCGAAGAATTCGAGTGGAACGCCGCTCAGTGCCGGGTCGTGCAGGATTTGCCTCCACCACACAAGGTCAGCGCGCATTGATGCCGA
AGCGCGGACGCGCAACGCGCGACGTAAACGGGACTCCTGGGAacgaaggcgctgcaagAAGGCTTGGGCAGGGCGCACGCAGGTAGCCACATGGCGCAGG
GAGCCCATTAGAGACTGGAAATCGCTGCGGGACAAGCTGGTCGCGAGGAGAGCCCTTGTGACGAGACGGATGCCTTTGTCGATCTTCGCCGGCGGCATGG
CGACGGTGCCGGCTGTCGTGTCAAAAATGAGCCCAAGCACTTTCTGGCGGGTGCTCCACGAAGTGAATTTCTGCTCGTTCACCGCCGCTGGGCCCAAAAC
CGCTGTCATCGCGTGGCGGAGGGAGCGCTCGATGTCGGCGCATCGGGATCCGACGTCCGCCGCGACGTTAACGTGGTCGTCCACCCAATGGTAATTGTAA
AAGCCCTGTGGGTGGGCGTCGTCAGAGTTGCAACCGTGGACGAACGCGACCGCACCGCCCAACACGCCGTAGATGCCCGCGGAGCCGGACCACCCAAAAG
CCGCCGCCAGGTCAATCAAGATGGCGTTGTCCTCCGGAATGTGGCCAGCAAAGTGGTGGACGCACTCACTGTGGGTGCAGGCGTTGCGGTATGCCGCAGC
GACATCCCCTGTCATCACCTTGATCTCAGCGTCGGGGTCCACGCATTTGCAACGGAGAATTGCACGCGCGATGCTAGAGGCGTGATCGAACGTCGGTCAG
GGTATTGTTGAGCGGTCCGTGTGATGGTTGACTGAGCCGTCGTCAGGGAATGACAGATCATGGATCGTTCTGCCCGTGACGCGCGGAGCGCCGTCGCCTT
TGTCGACGATGCCGAACGGGCTGATGAAGAGCTCGGGCCAAATTGCAATGATgtcggcgtcgacgactAGGCAGCGCAATATGTCTTGTTCTTTCCGAAC
GTTCTTGCGAAGGACGGTGATGCGCGCCGCGGCTGAAGGATGGTTGTGTGGAaagcagcgctggcaggCCGGTGTATCTCCCATCTGGACGCGAACGCCG
TCCGACGCGATGCTCAGGAGGTCATCGAGATGGGCGTACCCGCGGCAGTGGTTGCGCAGGGCAGCCGGAAGGACGCTTTTTTGGGGCGGTAGTCGTCTGG
CGTCTGGTCTCTGACAAGCTCGACGAACGCCTTGAGCGACGGTCGTGTCTGTCGAATGAACTCGGACATGGCTGCCTGGAGGGGCTTGTTGAGCTGAAAC
TCGTCGGCGGAGTTGTCGAGGGCCTGCGAGAGCGGTAGTGGCGGCAACGAGATCCTTGCTCACTCGAAGGCGCGCTGGATGGAGGCCCAACGAATTGCGT
TCCAGGTGCGGAGGCGGTGCTCTCCGTTCGCCCGTAGACCGTTGAGGTCGTCGACGGATGGAACGGGGCGGAGCGCTGAGATCTGGACGCTTCGTTGACT
GGGCATGCCGCCCGCGTGATGGGCGCGGACGGCACTGGGTCTTCGGTGGAATGCCCACTGCCATCGATGGCGGGGTTCTCACCGGCAAGAGTAGCCGCCG
GGGCGCGCTGTGCGCGTGGCGGCGGGATGGCAAACTCGACGGAATGGCCCAAAGCAGAGGGCTTCTCGTCGGCAAGGGCACCGGCAAGCGGGTGCAACGA
AGACAGCACGGAGGGATTACCCCTGAGGGCGGCGTCAGTGTCGGCGTGGGCATGCATTGGCGGTGCGACCGGGGCCGTGGGGCCACCAGGGATGCTCACG
TCACCGGGTCGTGGACGGGGCAATGGGGCATAGATGGGTTCACGGAGgctcgagcttggagaaTCGAATGTTTTCTGATTTATGCAAGCGATGGTGGACC
GAAGTGCGGgtgaaccagcagcacctcggctCCATCACGCGCGGGTGCGCGATCCCGCTTCGCGGCGGCCGAGTTTCTTCTTGATGAAGGTTACGAGAGC
GGGCGGTAGAGCCTCTGGCCACGAGTGGGTGCGGTTGCGAAACACGCATGTTGCGCGTGTACCACCGATGCACATCGACCCAGCGAAAAACCGGAGACAG
GGTTCAACGCCGTCGGCGTTTCGCGGGATGAGCTCCTTGATGTGGGCGGGAATTGCCGACGGGCGTGAGGACCCCTGGCGCTCTGCCGGCTCTCGCGAGA
CACGGCGAGGCGCGTCGACCACTGGAGCGTGGGAAATGTCCCGGGCTCGGGACATCGGAGCGTCGGTAATGATGGTCTCGCTAAGCGCCAGCGCCCAGGC
TGGTGAGGTGAACTGGAACGATGAGATGCGGCGCAAAACTCCCGCCACCATGAcggcgagtcgctggacAGGTGGATGTACGTGGCACCGAGGTGCTGGT
TCACCTCTTGCAGCGTCCGCTGCACGCGTGCAGGGGGGCTGTCGGGGTCGACATCCAGATTAGCCGCGACGAACTCACGCAGACGATACAGTGGGCGAGT
AAACACCTCATACCACTCGGCGTTGGCGAAGGTGGTAAGGTTTTGGATGGCGCCGAGCAGGTCGAAATAGGTGACGCACGGCGCTGATGGTGGCGGCGCC
ACGTTGGCCCCGAAGTCGAGGCTGTAATTCGCGTTGGAGGAGCCTGTGAGGAGGCGGGCCGCTCGGTCGGGGCACGCGAAGTTCATGGTCGACACGCCGT
AGCGGCCGAATCGGAGGCAGTAGGCAGCGGACAGGATCGGCGGATCGTCGGGGAAGCGGAGCCACTCGAG