Description :
From Genome Similarity Track
Location :
Scaffold_85:10379- 19934
Transcript NameFunction/comments
Phymu_g3832hypothetical protein PHYSODRAFT_493974
Phymu_g3833conserved hypothetical protein
Phymu_g3834hypothetical protein

Sequence
9555 bases(100 bases per row)
CTTGGTGCTCTCTGCAGTGGTAGTCTAATTAATCAACAGCAGTGTTAGAATCAAGGATTGCAGACCGAGTCCAGAACGTTATATACTCACATCAGGAAGC
TCAACATCAGCATTCAGGTGTAGTTCCAGAATTGGGGTAGCTTCTGCGAACGCAGGTGCGAAACCCACTCGGTGAGGCTCGCACAGTGCCCACAGCGCTT
GCATAGTCGAGAAATACCGCTGATTGGGATTGCTTGGAGGGTATTTGCTCGCCCAGGATCCATCCTCCCGTTGAGTAAGCAACAAAAACGCGATCCCTCG
ACGCATCTGTACCAGATTGCTAGAGCCTTCGAAGCATCGCAAAGCCTACGATATGGCAAGTTATCGAATTAGTGACTGATAGGGTCGCACAACAACTCAA
GAGCATGCTCATTTACCCGCAATGTTTCACCAAGTAGAGCTGCATCTTGTTGTGCCAGATAATAGACAATGTGATGTCGTAGAAAGAAATACTCGTGGGG
TAGAAGGTCCTGTTAATGAGGCAAGAAGACGTTAGAACAAGAAAGCGAGTAATAAACAGGGAGGTACTTGTATCAACAACTTACCGTTTCACAGCATAGT
TTTCCATGGTTCGAGAGCACAAACACGAGTGTTGTAACCAGGTGCACTTGGTCTTCATATTCACGAGGTGAGAGATCATTAGGGCCCTTGTACGGGTACA
ATGGCAGCaagtgttgcagcagttgcgGCAAGGAGAATCCAATCGATATCCCTAGAGCGTTCGAGTGATGCCATAGAACGAGGGCACTTGTCAGTCGCTC
ATAGATCGATCCTCCGTTCTTGCTATCACTAGGCAGAGGCCCCTCAGCCGGGTTCCAACCGAGAAGCGCCTGTACACCAGCAAAGACAGAGTTAAGCATA
GTTAATTAGTCGTTCAAGCGTCTCCACCCATAGGCAGCTCACCTTGGCTCCGTATACAGGAGGTGATCGATCACagagctccaacagctctACTCGCCTC
GCGTGGGAAATACCCACCCGCTCCACCAAGTAAACGGCCGCAATAGcgttgacgagctgcgtgggCGTGGGGACGGTACCAACGAGCCAATCCGCATGTC
GGTCCTGCTTCAGCCACAAGGCGCCGATGAGTCTCGCGTACAGTGTGGACAGTCGCAGCACCTCCCCCTCCTCCACTGCCTGCAGGTCGTACAGCGACTG
AATGGCGTGCAGTCCCCAGTCTGGAAAGCTCGCAGCTTCGCGAACCATCTGGTAGACACAGTTTAGGCCTTTCACCATGCTCTCGCGTCTCATTACGATC
TTCCACGGCTCCACAGTCACGCGCTTGGCCActttcttggccttgagtttacgcagctcctggtgcaTGAGCCGCTTGAGCACGTCCTTGTGGGTCGACA
GACTCACAtgcacctccttctccacggccTGCCGCACCAGTTTCGTGGTCAACTTGGACACGTCGTGGGTGGCGATCACGCCCGCAATGGCCGCCGCGAT
CTTGGCCTCCAGTTCCTTCGAGATCGTGCGCGGGTTGACGATGAGCGACGAGCCCGTGGACGTCATCTTGGTGTACATACCCCCCGCCATACTCGAGAAG
CTACAGATAAAAAACACACAGATATAACCCAGGTTATATCATTGCCACATTGGTTAAATAGTTCCTCCAATCACAGACAAGACCTCGCGTGTGTGGCTCT
CCTCCCGTTCCACCTACTGTACAAGATAATGCTGGCCCGTGCTCTCCGATCGTCTGCGCTGTCGCGCGCTGCGAGCCGCCGCTTCATCGGCGGGTTCGCG
GCTGATGCTGCCGTGCCCACTGTGGCCGAGAAAGTGTGCGTGTGACTTAACCCTTTGTATTAACCGCATTCGGAGTAGGAGTTGACGGCGTTCTGGTGGT
CTTGTGCAGGGTCAACGTGGTGCTCGTGGACTACGAGGGCAACCGCCACGTGGTCAAGGGCCGCGCCGGCCAGACGCTGCGCCAGGCCTGCGAGATGAAC
GACGTCGGCTACGTCAAGGACGACTCCAtgggcggcggcggcgtgtACAACGCCAAACGCGCCGACTTCTACACCGAGTCGCTCTTCGGCGAGGGCTCCA
CGTCCCCTCAGTCGCACGTGGTGGTGTCCAACGAGTGGATCTCCAAGCTGCCGCCCGCCAACAACCAGGAGCGCCACATTATCGACACGTACGTGCCGGC
GGAGGACCGCTCGGCCAACTCTCGTCTGGGCACGGAGAtcgtgctgcagaaggaccTGGACGGACTCGTCGTGGCTGTGCCTGAGGCCCCACCCGTCGAG
GAGTACGAGTACGACCACGAGTACGACGAAGATGATTACGAGTCGTACGAtgacgagcaccagcacgctTAAAAGTAAGGAAACACTGTGGATGTCTGTG
GGAGAACGGCATGTGAGCTAACCCCCAAGTCGACGCCAGTCTGTCGAATCCGCTACCACAAGtaaacaagaagaagaaaaaaaagagaatACAAGGTAAC
AAAGCGCGTTGGGCTGTATCTAACCTCGCTAGTCTTTGGCCTTTTTCTTCtgtgcagccttcttcttctcaagctccagcttcgagcgGTTCTTAATATC
ACGTCGCTTCTTCACAGTGCTGGAGTCGTTGGGTGCAGTGGGAGGCTTTCGGGCTTTGGTCGGAGACCTATCGCTGTCTCTGCCGTCTGTGTTGTTCCCA
GCACCGTCGAgttcgtcttcctcatcgccaTAGCATtcctcctcgtgctcttcatCCAACTCGGTGTCCACGTACGGGTTCATTTGACGCTTCTCAGTGC
GCGACACTCGGATGTTGTAGCGGAccttgtcgtcgtcactgcgCGTATCTGATGGAAGACCGGCAGAATCCGGTTGCCCAGTGAAGCTGACCATTCGAGT
GGAGTTCCTGTGCCGGAAGCTGGGGCTGGGAGCCGCCTGGAGATGAGCTTCCTCCCCAAGGACAACTCGCACCACTTTTTCAATCGAGTCCACGAGTTCC
AACGCGCTCAACTGCTGGACACTCGCCACGCCCAAAAGCTGAGCGATGTGCAAGAGTCCGAGTTGCAGTCTCTCCTGCAGTGATCGCAGCCGTGCAGCAc
gctctttcttcttctgcttgacgGCGTTCGTCTCAgccaactgcttctccagcatcttgacaTTGACGCTGGCTttggaagctgctgcatcgccGTCCCC
GTTCGCGTTGgacgcgtcttcttcttgagagCCTTCGACTCtgccactggagctgccgctgaGCTTGAGGTTCACGAACTGAgtctgcaggagctccagc
ttgtcgCGGTACTCGAGCACGCGTTGCTCTGCTTgtttctcttcctcttcgagctGAATCGAGTGCTCAAGCTGGTTTTGCCAGCACAGCAGAGCTTCCT
CTGGCTTGTTAATACCAACTTGTCGGAGGGCACCCAATATCCCGTCGTCCTTGTAGGCACTCCCCACGTACAACTGCAGATTCTCCGCGTACTTGTGTCG
AACTAACGATGTCTCCTTCATGTGGATCAGCTTGTCCTTTGCACGGAAGAAGTCGGGGTCGACTGGGGCGGTTTGCGACTCATCGTCGGATGCGAAGCTG
ACGCTCGCACAGGTGGCCCCAACGGAAGCGAGGCTGATGATACCAGTGCTGGGGGCGTTTTTCTTCATTGGGGAACCTGAGACGTTGGGTTTCAGGATCT
GCCCAGCATCTTTCGCTGAAAGACTGGCGTAGTACAGTCGCCGGTCAAGTTCCTGACGCCACCGCAGTCGCGCAAGTGCCTCTTGATGGATCGAAGCCTT
GTCCTGAGTGACCTGTACCAGTTTCGGGACGTCCAGGCTCGTAAGTCGCTTCTCGTACGACACCACCtgcgccttctgctgcagctccacgatctccCGC
TTCAGCTTTGCCACAGTCGCTTCTGCGGTTTCGATAGTCTTGGGGTCACGCGCAGGGTTCAATTCGCAGTGGCGCAGGATCAACTTGTAGTATTCACTCC
GCTGACGCCCAAGAGAAGCTTCGTCATTCACGTTGCGGATGCTTTCGAGGAGGTCATCGATCTGCGAGGCGTTTCTACCCGCTGCAGTGATCTCGGCTTT
CGCGTCCATTACGCGCGAGTCCAGCAACTTAAGggcgtcgctcttctccCGTGCAGCAAACTTAACCCGGTCATACTTCGTCCGGAGCTCCATCAGTTGG
CTCTAAAGTCACGCAGCAAACGCATTAGACACCGAACTCAGCTGCAACCAGCACGTTGACACGAACCTCAAGTTTGGAGACGGAACCCAACGAGCCCTCG
CTATTCTCTGCTGATAGGAACTCTAACACACCCATTTCGTTGTCCACAGAACTTTCAGGTCCAGGCGAAGGTGAAGTCTTGCGTAGTAGTCGGCGTTTTG
CTGGGACCAACGATTTCTTGGTTTTGACGATTCCTTTGGGCAGAACGACGCCTACAGGGCTGTAAGACACCTTCTTCGTACCCGCAGCTCCTCTCTTTGA
GGGCTGGGTCGATTGATCGCTCGATTCAGAGCCAGTAGACTCATCTCGTGAGCCAGCAGCCGAGTCGTTTCGACCACTGCGGAAGACACGATTTTCAAAC
GCCGTACCGATCAGAGGGAACTGCGTCCACAGCCACCGTCGAACATAGTAACCATCGTCTTGGTGGGCCCCGAGAGCATCGATCTCTTTTTGCACTCGTT
CTGCCTCACTTTCTGATAAACTCGACGTCGAAAAGCTGCCTAAGCTCGTGAGGAACTCCTGGAGTTGAGGGGGTTTGGGTCGGTTGAGTAGAAGGTTGAC
GACACGAGATTCGTCAACTTTCTGCCACGCTCGCAGGAAATCGGTGATGGTGAGGAAAATGGACAGCAACTGCTCTGCACTGGGCGATTCCTGGACGATG
TATTCATCCAACGACCGGATGAAGTCGTCCACCGGGTCGTGCATGGAGCAGTTTGCCGATAAAACCATCCAGTAGAAGAAAAACTCTTGGCGATTCCGCT
CGCTCCACCACAACTGGAACATTCTCATGTTCACCAGAGCGTTCTGCAGTACCCCCCACATGGAGCAGCGCTCGAGTTGAACAGGCAGTTCGTCAACGCG
ACGCTGGCAGGGCTCCATCCCTTCAAAGTACACCGCAAGTTCGCGATAGTAGCAGTTTCGAAGCTGGTCTTCACCAAGAAATCCGTATCTCGTTAGGAGC
CGAAGCTGGTTGTGGCTGATATCATACAATACCACGGGATCCCCTCCGTTCTCTTGGTTCCCACCGCCTTTAGTGACATTGCCAACAGCCCCCACGACGA
TGTGGTGAGGCTGAGTCACTGGGCCACAGTCGTATCTTCGTATTGCCATCAAATGGGGccggagcagcagcaagagctgctgaCAAACACTCCGCGGGAT
GCTGTCGCCAAACAGCCGAACGAAATCGTTCTCCGATAGCCCGTAGCGACacacagcaagaagcgacAGAGTGTGGCGGATCAAAAGCGCTCGCTGCTCA
ATAGTGACCTGAAGGCTTTCAATATTTCCCTGGTCAGTGGGGCTGCTTGGGGCGTTGGGCTTGGATGCGACGCCACTGTTGTTACTGCTCCCGGCCACTT
CTTTCCCTTCCAAACCATTTCGATCGCTCGATGCCTCTAGCAAAGCAGTGCGCTCGTGAAGTTCTGTGAATAAATCTTTCAGCAGAATCGAATTCCACTG
CTTCATCAGAAGTTCATAGACGACATTGAGCTGGTTGGTATCACAGGCTTGTTCTAGCCAATGCCGCCGTTGAGAACTTTCACTCGGatcgaacagctca
agcCCGTTGAGCACAAGTCTCACGTAAAGTGGGCTGGAGCTTCCACAAGCTCCGGCAATAAGTTGTTTATCTTGGAGATCTATTTCACGAGCAAATTTCT
GCTCGTACATCTACACAGCGAACACATTTCGTTCATCAGATCTCTTCGATTTCACTGCGAAAATGCAAATACGACTCACCTCAACAACAGCCAAACACGA
AACCTCATCAAGAGGTTCCACGACCATGAACGCCGCGTTTCGCCGACGCAGCTCCCGGATTGTGTGCGACTCTTTCTCGCGCGGTGGTAGAGTCGTCTGG
TAGATGAGATCTCCACTGAGCAAATAGGAGCAGGACGTGAGTGTCGTGTTTGCCAAACACCAAAATGATGCACTAGCCAGTAGACGTACTCGCTGTCGTA
CACGGCTGGCTGACGTACAGTCTTCTGACTGCGATGGAGGTGGCTCTTTCCACTTCCGTCGGTCTGTGTAGTTGAGACAACAATGCGGACACCAGCAGGA
AAGGTATTTGGAAGCCAAGATAAGGAATCCCCTCCGTCTTCTGTCCTAATGCAGTCGATACCATCTAGAACGAGGACAATCCTACACACAGCAGACGCGA
GTTAATTGCCTACTAAGCATCAGAGCCGCGAATTTGAATTTCGTACCGTTTCCGCTTCGAAGTGGGCCCTGTCGTGTGCTCCCCTTTCCCGACCGCAGCC
TCTAGACAGCGGCTGAAGGAGAATTTcagcttttcttcttcgtgctcgcgCGGGAGTTCAAAGTCGCGCAAACTGTAAGATATTTTCAGCTGGCTCATGA
ATCGAAACAGGAACAACGAGAGCTTGACGCTGTCGTACGAGCACCCGCAGTAGTGTTCGTAGATAAGCTCCCGCTCTCCTTTGACTGAACGACGTCGCTC
CTCTGCCCAGTTCGCGAGCAGCGCTGACTTGCCGTCTCCAGGCTGCCCAACTACGACCAGCACAGCGGATCGAGCGTCACGGTCCAATTGGCAATGGTCA
TTCAGAATGTGCAGGTAGTGGCTAGTGGGAGCGTAGACGAAGTCTTCTTTCCGACTACCCAAAAAAGCAGAGTCAAGTTTAGTTGAAGCAGTGAGTTGTG
TTTGCACAAGATGTGTTCGCCCTTACCTTCTAGCAAAAGCGTGATGTGTCGCAGTCTCACGACTCACAATTGTACTCTCCACTCGAGGGGAAGTGGACGA
AACTCCGGTGTCTGCGTCGTCGAATGAAGCAGATCCGTTGTCAGATCGACCAGTACTGGACAAGGCTCTGCTCCCGCCGAGTCCGCTTCCTTTCTTACTT
GGTGACGGTGCCTTCCCCATGTTTTGCTCAGTCTGTGCTGCCCCTTCACGTCCCAAAACACCATCGCTGAAACGCCAAAACGATAGTCGCCTGCTCAAGA
AGGTTGTTCAATATTTAGCATGTGCAAGCGCCTCGATGTTCACTGATCATCTACTGTTCTTGCTCGCCCATCCGTCGCAAAGCTGCCAAGCGAACTTTCT
CGCGTCTGTCAgccagcgtcgacgactcCGCGGACGATGAGGACTCCGCTGTGCCGCCTACAGTTTGACCAGAACCTGAAATCAACACCACGTACACTTT
AGTCGTTCCTGCCCAGAAGCTCAGTTGGAACATCGCACAAATGCACCTGCGAATGGGGTGTAGATAAAGTCCGAGCGTCGTGGAGCTCCGTTCGTGATCC
TTTGTGGCGTACTGGGGTCGCCCACCGGCGCTTGGTCCGTCATATCCGCTGGCATGAGGCAGCTGAGGAACGAACCGAGATACGCCGCGCGATTCACGTA
GGCTGGGATGGgcttgcccagcagcagttggcACAGGGCGTCCGCGTACGTGTTACAGTTCCTACGGTCAGTCGTCAGTCTCCTGTCCGTCCATCTATCG
GTCATAAAACAACGCCCTACTTGGTGAAGAGGTTGTACGAGTCTCCCTCAAAGTCGGAGCTCAGTGAGTAGGCCAGTCGATGGGCCTCTTGGAAACTCCC
TTCGAAGAACCCCATGTCGATCGATTCTCGGAATTTGGCGCCTGCAAAAGACAGCAGTGCAGCTCAGTTGGAAATCCGCTATCATACTAAAATGTTGTAC
CAAATGCATCTCTGTGTGTGTACCAGGGGCCTGTTTGGGactcgaggagaagacgccgGCGCCGCTCGCGTACGAGAATTCCTCGCCCGCCACTTCGACG
CCGCTGTGGAAGATGCCGAGGCCCAGCGCTGCGAGGTGAGGGGGTCGATTGTTAGAAACGGAAGGCAGCAGACGGGGGGGGACAGTAGACACACGCAAAG
AACTCACGCGCCATGTACTCGTTGGCCTCTACGAGGTCGTAGACGTTGAGGATCACGGCAGTCCGAGGCGCCATTATTCCACCCCGAAGAAAGTCTCTGT
TTTAGAAAAGTTTTCTATCGCAGTtagaaatggctacatttttGTTGAAGTGGGTTTATGCTGCCGACCTCCTCTCTTGATGGCCTCCTTCCTGGCCTTC
CACGTGCTCTCGTGCCCTCCGCGACGCATggcgagctccagctcctgctccagaTCGTTGTTGCGCGCGTCGAACCGCTCCAGTTCGGTCAGTGCGATCC
ACTCGAACAGCGGCACGATGCTCAGAGCGCCCGGAGCCAAAAGAGTCGTAGCCACTTGTCTAGCGAACCTCAGAGCGCTCTGAGGGGTGGGGAAACACTG
GTAAACGTGCACTACGATAGCCTCAATGCACGTGGCCCCGGGCGGTTGAAGACAGACGCTCACACATGCGAAGCGCTGGCCTGTGGCCTGCGGCAGGTCT
GAGGCGCTGAACTGGGCGGCATCGCTGACGCCTAGAGCCACACTGGGGAAGTTCTCCAGCGCCATCGTcatctcgtcctccttgtaGACTGCGAAGCGGC
TGCAGTCACGGATGTCCGATATCCCAGCGGTTTTCTCGACTGCGCAGATCTGGCGGAACAGCTCCAGGGCGTCCTCGATGTCTCGGAACTTGCCGAACAC
CCGGAAGCGCGTGAACTCTGGATGGGGAACAGTGCTTACAGCTGCCACCGCTGCTTTGCGGAGCTGATCCGCAGCAGACTTTGCTGATCTGGACGTTTTG
CTCGTagacaacgacagcgagatGCCCCTGGATGCCGGTCGAGCGGCCTGTTCTTTCATGAATCCCAGCACGGCAAAAGGCTGACACACGCCGTGGATGG
GGTCCCAAATCGTGGCGGCAGTGGCAATCGCAGTCGTCGACGCTCCTGTGATGCCGTTTTTTGCAGCGATGAGCGCATtgtcgagcttctccactcgaAC
TCGTCCGCAACGACGCAACTCGCTGCGAAATTCCGTCGTTACCGCCGTGATCGGAGACGCCGTAGTCAGCAGAGCTCGGGTGCTCTTTTCTAtattgctg
ctgtcggccCGACGATTCAGTGTTTTACTACTACCGGAACGCGCGAGGGCGAGTGGTAGTGAGTGAGGAGTAGCGGTTGACTCGTCGTGTGGCACAGGGG
GCAACTTCGCCCGACTTCCTCCATGCTGCAATTTCGTGCTTGTTGAATGCTCTCGCTGAAGAGGTGACACTGAAGTGGATCGAGTCCCTGTTGCAGGGAG
AGCTACAGTGCCAGCATTGTCTTGAGAATTATGTTGTATTTCCTCTGCAATTACGGCGCTTTCTTGGGCTTCCTTTGGGCTTCCATTTGTTTGCTTCGCC
TGCGTTCCAGATGCACAGACCTTCGACACTCCTCGTCGACGTTCCAGCATGAGAG