Description :
From Genome Similarity Track
Location :
contig_60:103779- 105776
Transcript NameFunction/comments
g9062.t1hypothetical protein
g9063.t1hypothetical protein PHYSODRAFT_248239

Sequence
1997 bases(100 bases per row)
ACGTGCGTCTTCCTGCCAAAGTCTTGACTCCACTGATCGCACGCTCCCCCGAGGATTGTGCGAAGTTTATGCTGTCTACGCTGACCAAGGACGCGTTCAG
CTCTGGGTGGCACTTCGTCAACAAGAACGCGGAGAAGCTACAACCGACCAAGTTTCAGACGAACGAGCTGAAAGAGATCGTGTGGAACCATTCGATCGGC
ATTATTGACGATACACTTGGCCAGAACGCGAACCACCCTTGAATAACGTTCGTGCTCAGGTGGATGGAGCGCTCGCTAGTGACCAATATTTTCCACGACA
ACAACGTCATTTCGTTTAGTCCTATGCAAAACCAAAGTGCCATCTACTTTTTAGCGAAGAAGTTCAGACGAAATGAAGAATACTGTTTGAAAGCACACGA
TGACCTTTCACACTCCGGAAGATCTTTCAGGGCGTCCCTTTACTCTCAACGCAAAATGGCGCACGTTAAGCACGCTCTCGTTGTTGGCGCTTCATCCGGC
ATCGGTCGTGCGGTGGCACATGAAGTGGCACCACTTGTGACGACGCTAACGCTAGCATCTCGCTCTTGCCCGCCCGACTTGATCTCTTCCGTCAAGGAGA
GGAATCCAGACGTAAAAGTGACCCACGTGAAGCTCGACGTGTCAAACCTGCACGAAGTTCGACAATTCACGAGCAAGCACAAGGAGGCCTCTTTCGACTG
GATCATTATGTCACCGGGCATTCTGTCTTTTAGTGGACGTATCGAAACCTCTGAAGGCCTCGACATCAAGATGGCGACCCACTACTACGGACGGTAAGCT
GAGCGGCCGAGGCTGTCCGTGAGGGTGAGACTAACTGACTCCAATATTGTTCGTAGCTTTATGATCGTCAACGACCTGCTTCCAACACTTAACCGCACTG
GGGTGCGCGTGCTGAATATTCTGGCGGCAGCAACCGGAGGCAAACCCGATGTCAACGACTTGGGTCTCAAGAAGACGTTCACCATCAAGCGCTGCGCCGA
CTTCACCACTACCTACTCGTACGTTGAAAACCTTGTCTTCCTCACTGAGGCTGTCAGTGAATAACCGTCAATGCTGCTACAATAGGGACCTGATGGCCCA
GGCCTTCTCGGAGAAGGCACCTCTTGCCAGTTTCATGCACGCGACACCCGGCGTGGTCGCGACTTCCCTTGCTAACAACTTGCCCTGGTACGCGCGTCTT
CCAGCAAAGGCGATCTCAGCGCTGATCGCGCGGTCGCCGGAAGAATGCGCCAAGTCCATGATGCTAGCGTTGACCAAGGACGAGTTCAGCTCAAGTTGGC
ACCTGGTCAGCAAGGACGGACAAGCCCTGCAACCGACCAAATTCCAGACGGAGGATATGAAGGAGATCGTGTGGAACCACTCGGTGAGCACGATTGAGAA
CGTGCTTGAGCAGGTATAATAGACTACAACAACATGTAGGGACCATGAGTCGAAGCTGAAAGTGCCGTCCGACAATCTTGGGTTACGTTAGGAAGTTTGT
AGCAAGACTACGAGTCTTCTGCATGTGCACCTCATTGTCAACCGTTGACAGGAGTTCCAAACCTTCGCAATTATTTGCTGTTCGAGCTGATGGGACCGTT
GGAAGAGCCTCGCAGTACGGGCCGCACAACGCTGCGTTAGCAATGCCTCTATGCACCGCATCTGGGACCAGCAAATTGACCATCGTGCATTTTACTCCCC
AACGCCCGAGACTCATTTCTGCTTCTCCACCCACAGGGCCAAGCTTCCTAGCAGCTTGAGATGATGCGTTCTGCGTCGGGGTTGTTGGTGCTCACGCTGG
CTGCTGCAGCCCGCTGCGCTACGGCCGGATCGGGCTTCAGCGGGTCCTACGATCCCTCTCACACCGTTAACATTGCGACCGTCACCTCTACCTCGGTCGT
TCAAGACAACTCGTCATCACTGGCGGCAATGTTCCCCATTGAAGGAGAGGCGATTGACATCGCACTGCTGGCCAACAGTACAATCCCAGACACGTGG