Description :
From Genome Similarity Track
Location :
Scaffold_106:103771- 104774
Transcript NameFunction/comments
g9484.t1XP_009518488.1 hypothetical protein PHYSODRAFT_324431 [Phytophthora sojae

Sequence
1003 bases(100 bases per row)
TAACGAGAAACACACCAAGTCTCAACACGTACGTCAACCACAGTGTTGCGCCGCACCGCTTCGCCGTCTCGAAGCACACAGCGCATAGTCATGAGATTGA
GCCGTAGAATAGTGACCATCATGGCTGTCATGCCGTCGTCGCCACTCTCGTCCGGGTTTTGGCCCGATTCGAGCAGGAACTGCATCATCTCGACGTTGCA
TCCCCAGGCCGCGGTGTGGAGTGTTGAAGCACCGATCGTGCGGAGGTGAAAGGCGCCCCAGCTGCAGAATTTTGCCTGTCGCTGCGACGGCGAGTCCGAC
ACCGGAGACCCGACGTGCTGTAGCAAAACATCCGACAAAGTGTTAGTTCGATGGTCGCTGCTGGTGTTGACAAGACGATGTTCGTACCCGATTGAAGTCG
AGCCACTCTGGGAATTGACGCCACAGTTGGCGCATGGAGGCTATGTCGTCGGCGGCACCGGCAGCCAACCACGCTGCGTGCACGTCGGCCATGCTGGACA
AGGGGAATTTTGCAGTCGCTTGGGCGTTCGTTGCGTTCATCCGGAAGAGAATGCGATAGTGAGGTCTGGTCTCGAGTGATCGCACACAGACCGCATACGG
ATGAGTACCACGTTGATGGAGGTGAGTTGGCTGCGGCGGCGCCGATAGAAGTCTCGGCAAAAAAAACGGTTAGTATGAGTTACTCCATGAAAAGGCGCAA
TTTCAGAACTGAACACGCAAGTCACAGATAAGGCTGGCTACGCCCGTGGTGGGTTGGACAGAAAGTATCACCTCGGCTCTGTGCCACCTTGCTTGTCGCA
ACCAAGTCGTGCTCGGCGAGGTTCGGCAACTACCGATGCTAGTTGCGCCGCAGATCTCTTTCATGAAATGGATCCACACACGAAAATTCCGTAAATAGTT
TGACTCTGAAGCTCGCATCGGACTCGCGCATCGACAATAATACAGCAGATCCAATATTTCATGAAAGAACACGGACTTACATCGTGTTTTGGCGACACTT
CAA