Description :
From Genome Similarity Track
Location :
Scaffold_1158:10374- 13210
Transcript NameFunction/comments
Phypl_g12601hypothetical protein

Sequence
2836 bases(100 bases per row)
CGGCCGAAACCGCTCATTGTGAGCGTCAAGACTTTCGAAGGGAAGGAGGGGGAGAACCTCATGCTATGGATCCGTGAGATCGAAATGGCGATGGGACCAG
CCATGCTCCGTACTGAGCAACAGCGCGTGGCTCTAGCGATCTCTAAGCTcggaggccgagcgcgagaatCGGCACTCACGTGCGGCTCGTCAGTGGACGC
TGCCTTCCCAGGTCGGGTAgagcagaagctccagctctcgcGAGTGTTCACTCTGCCTATTCAGAAATATTGCGTGAGGTCACGCTTCCTGAGTACCCGA
CAGGGTAAGAAGGACTTAGTAGACTTCGTCCAAGAGTTGCGAACTCTTATCGCTGGTATGGCGGTCGAACCTCTGCCGGAGGCAGTGACTGTGACAGTCT
TTATGGACGATCTCTGCGCTGGCGAGGCCAGGGTGGAGACCTTCCGCACTCGCCCTTCCTCTTTTGAAGAGGCAGCAAATGTGGCGTTGAACGCCGAATT
CAATTTTAAGGCATCCCGGCTTGGATGGGACGCCGCTAACGCTACTCCGTCCGACGGCGCGGTGCCCATGACCTCAGCtatgctgaagacgaagaaaaag
agcttcaagctgccgaGCAACGCATGGGGGTTCACCGGTTCTTCATCTGCCGAAGCACCACCCATCTGAGGGCAGCCTGCCCGTCGCGCAGGTCGCGCCA
GGCTCCTACGAGTCATCGCTCTGCTTCGAGCCAAGCCATCGGCTCGTCGCGGGGNCCGTACCCTCTAACACGGAACGTGTATGCAAGCCGGGCTTGCTCG
TCGTTGAGGCAACGGTGAAGGGCTTTGAAAAGCCATGGATCATCCTGATCGATTCCGGAGCGTCGGGCAACTACGCTCGACGCACCACGATGGGAGGAAG
TCAGCCGTACGCTTAGGCGCTTGGAGCGCGCAGAGGTGACATCGTCACTGTTCGCCTAGCGACAGGGACCCGCGTCACGGTGCCCAAGGTCCCTGTGGGC
CTGAGCGTGAAGTTGCTCGACTACTATAGCGTAGAACGCTGTCTGGTCCTGAACCTGGATTTGAGGTATGACCTCATCCTGGGCGTGCATGGCTGGAACG
CCATGATCCATGGGTTGATTGAAGGTCGAAGACCTTGTGCGCAACGGGCTTTACTCCTACTGGAGCTTTGGTGAGTCATGAACCCACCTCTGCTAGGAAG
CAATAGCGCTATTGGCGCGGGCACTTGACCGAGTCGGTCAATGTGTTGGACATCGCAGTATCCGAACGTGTAGACACTGAATGTGTCGAGGACAGGAGTT
CCGAGCTAGGCACGTGGGCTGTGAATGGGGCGGCAGGTAAACTGCTGGGTGACACAGGTGACATGTgtcacgacgacgaggtgtcGCTACACACTATGCG
TGGTGTGACCGGCAGTATTCCGGGACATCAAGGCCGCGGGCCCTCTGATGGAGGTGACGTGGCATGTAATCCAAGGAGTGGAGACTGcgagcaactgcag
ctcTACGACGGGTGTTGGTGAATACATACCAGACGCACATGGTGCGAACACctggagacgctgccggTGTGACTGTTAGAACCTCTGCGAGGCAAACAGT
CTCAGCGGGGAGAAGGCTGCGACACCGAGCGTCAGCCATGAGACGCAGGGTGTCTGATTCGTCTAGCATGACGAGTGAGACCGCTCCTggcgacagcgag
cagctaTATATACTCGTCAACGGAGTGACAGGGGAAGTCGATGGTGTCATCAGCCTAGAGACACTTCCCACCATGGACGCAttgttggagctggacgaga
tgtcCATTGCCGAGTTCGGCGACGCCTTGAAGGCCGGCGAGTTAGCCGAATTGGTCATCACACGAGTTAAACTCGTCGTTGTTTTTGGATAAAGCAGTCC
TTGAGGACACTAAGTAGGCGCTGAATGCGCGGGGAGGATCCTCCATCCTCATGGACCCCTCGGATCCGTACTCTCCTTTGGTGAAGGAATATCAAGACGT
GGTCTCGAAGGAACTCCCACGACCTCCGGATCGAGGTGTACGTAATGAGGTTGACCTGGTTCCCGGAGCCAAATATTGCGTGACAAGGCAGTGGCCTTTG
CCACGGCAACAGTGTGACGTCATTGACGCGATCTTCCGTGCCAAGCATGAGGCGGGTATGGCGCGCGCGAGCAAGTCTCCGCACTCAACGTCTACGTTCT
GTGTCAGAAAGCCGAGTGGCAAGTGGCGTATCGTTCACGCTTTCAACGTGGCCACCATTCCGGTGCAGACGCCTACCCTAGGAAGGACGTTCTCCAGAAC
AACATGACAGGGTATACGTGTGCAATACCCTCCCCTTGGTCGATGGATACTATCAACCGCTCATGAGAGCAAGCGATATTCCGCTTGCAGCAGTCAGCAC
TCCGAGTGCTGTAAGCGGAATATCGCTTGCCCAACCCCAAAGGCTGTCGAACGCGCCTGTGATATTCTACCGTCTTGTAACGCAGCTGTTCAGGCCCCAC
AAGGTGTATGCTCAGACACACTTCGACGACACCTTCGGCAGCAGCCATGCTGAACACGGAAAGCCTGACGTGGAGAACCACATTGAGCACCTGCGAGCGG
TGCTCGAGTGCATGTCCACACACAAGTTTCATGCCAACATTGGCAAGTATGTCTTCGGCGCTGAAGAGATCCCCTTTCTGGGATGCTTCACTGGGAAGCG
AGGCCTTCGAGCAGATCCCACTAAGGTCAAGGCCATTGGATACTGGCCGGTTCCAAAGAACCAGAAGGACTTACGAAAGTGGCTTGGCTTGGCCAATTAC
TTGCACAAGTACAGCAAGAATTATGCTGAGGTGGCA