Description :
From Genome Similarity Track
Location :
Scaffold_339:10374- 13009
Sequence
2635 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CCGAACGGCAAGTGGCGCATCGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACA
ACATGGTAGGCTGTACGTTGTACAGCGCGCTGGACTTGTTCGATGGTTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTAC
TCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGTTGTTTAGGCCCCAC
CGGGCGTACGCTCAGACGTACTTTAACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGAATAACCACATTGACCACTTGCGAGCGG
TGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGATACCT
TTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACGGGCCGGTTCCCAAGAACCAAAAAGACTTAC
GCAGGTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGCGCGAACTACGCGGAGATGGCTCGGTCATTATCAGATCTCCTTAAGAAGGACGCACCATG
GTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGCGCTACCAGACCCGGATAGTCCGTTTAGC
GTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATTGCGTTTGAGTCTCGCCAGCTCA
AAGCTGCAGAGTAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTT
TGTGATCTTTACTGATCATGCGTCGCTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAAC
TTCGAGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAATTAGCTCATGTCACGACATTGACGTCGT
CAGTGCCTGACTTGATACGCAGAGCGTATGCACAGGAAGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGCGTTTAAAGACTCTGACAAGGA
ATTGTCTGCGCGCTTACGCGCGAGGCTGCATCGATACTCGCTCGATGGTGGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCCTCGTGTAGTCGTT
CCTCATGATGATGATCTAAAGTATCGAATCCTCTATGAGGTTCATGATACGCCGGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCT
CGATGTACTGGTGGCCCAAGATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAAAGTCCGCGCCGAACACGGCAGCGCC
ATTGGCGAGTTTGCCTGTCCCCAAGAGATGCTGGCAGTCCATGAGTATGGACTTTGTGTTTGACCTTCCCAAGGATAAGGCGGGAAACACAGGTATAGTG
GTCTTTGTAGACCGATTGAGCAAGATGGCTCATTTAGCGGCAGTGCCGGACACCATTGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTC
GCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGATCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGA
CATGTCCACGGCGGACCATCCGCAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCCGAAGCGTATGCGCTGAGGCGCCAAAA
CGCTGGAGCCAGATGCTCCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAACGGCTTGGTTAACC
CTCGCGTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGGTGGGAGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGCTCGCAAGCA
AGTCGATGACTTTTGTCTCTTTGAGACTGAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACACGCAGAAGGAACATGCAGATGCCCA
AGGGCAGAAGCAATGTTGAGAGGTTTGAGGTCGGTGACCAAGTTTTATTAAACGCTAAAACCCTACCTACTCATGCCGGGGTCTGCAGTCTTCAAGACGA
AGTTAAGACCTCGGGTTCATAGGACCGTTCAAGGTCGTGGCCAGGAAGGGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGCACGCATCCGGTCT
TCTATGTCGGCTTGCTTAAGCCATACCAGGACCCT