Description :
From Genome Similarity Track
Location :
contig_12:103724- 106011
Transcript NameFunction/comments
g3731.t1RAW28904.1 hypothetical protein PC110_g14728 [Phytophthora cactorum
g3732.t1hypothetical protein

Sequence
2287 bases(100 bases per row)
CGACGGCCACGCTGGAGATCGCGCCTCGCGCTTCTGCGCCGAGAACATCTTCCCGCGGATCCTCGAGCAGCTCACCACAGAGTCCACCGTGAACGACGCC
ATTACAAACGCCGTCCGGGCACTCGGTACGCTCGGCAAGCTGCTCCTTGTGTGTAACCTAGGCTAACATTTCTTCCTCCAGATGCTGACTTCTGCACTAT
CGCTCGCAACAATTCCAACTCCACACTCGCCGCTGCCGCGCGGAGAAGCCACGGACGCTCGTTCGCCACGGACGACGGCTCCACGCTGCTCGTCGCCATG
GTGCGCGATGGCCTCCTACACGTCGGCAACGTCGGCGACTCCCGCGCCGTGGTGGTCACCCGCAACGGAGACGCCATCGCCATGTCGTTCGACCAGAAGC
CCAACCGCAAGGACGAGCGCGAGCGGCTGGAAGCCAAGGGCGCGTTCGTCACGGGCAAGCCCGACTTCATGTACAAGGTGTGGCCTCTGAAGAAGATGCT
GGACGTCCCGCGTGTGAACGGCCAGCTGGCCGTGTCGCGCTCCATCGGGGACCTGTCGCTCAAGACCTACATCTCGTGCGACCCGGAGGTGCAGACCCGC
AAGATCTCCAAGAACGACCGGTTCCTCATCCTGGCGACCGATGGCCTCTGGGACGTCGTTACAACAAGATGGCGGCTCAGCTCGCGGCCAGGTTCAAAGA
CCCACAGGCTGCCGCGGACGCTCTCGTCGCACTTGCACTGACCGACACACGGTCGACAACGTAACAGTCATGGTCGTGAAACTCGAAGCGTACGACTTCA
CCACCAGCCGCACGGACGTCAGCAACGACTGAGCTGGCACACACACAGCGAGTCGCATCGGGACGCTCGCTACTTCTACGCTAGCCACAGTTATTTAGTC
TGTCCTTAATGTTAATGCTGAGTTACTTCATCCGTCCGGCCAAATGCTTTGTTGCTTTGTTGCCTTCGTCGGAGAAAAATCCATCATCCAAGATCTTTGC
TCATCAGTCCACCAGTCACTATTACCTCGCAACAATGCCACCCCTTTTCCTGCAACAATGGGTTGCTATTTCCGGGTTAGGCGGTACTCTCCCTTCTCAA
GTCTCATTTTCGCATACACGAGCCAAGTGGGACGTGCCTCGATGCCGGCGCTCGAGGTGTTCGGGCGCCGCAGCCGCGTGGTGGGCAGCGACGACCTGTT
CTGCCCCGCGACGTTCCTGCTGCTGTATCAATTGCCGCTGGCGCTGCTGTGCGTGCTGTACGCGAGCGTGTGGCGGCGCTGCTCGTCCACGTCGCTGGAC
GACCGCGGGCTCCCGTTCTGGTACATTCTGGGCGCGGCGCCGCTGCTGTTCTTCCGCGGGTGCATCTACCTCATGATCATGCACGTGTCGGCCAAAGGGA
CCATCGTGGACCACGAGCGCCGCGTGCTCATGCCGCGCATGCTGCAGGTACATGCGCTCTGGTCCGTTGTGCTCTTCGCCTACGGACTGCGGGCGTCTGC
TGCTGGTTCTACCGAGACATGTGCCACCCGGACGCGCGCTTCGTACTGGTAAGGGCGGATCTTTTTATAGATGGCTACTTTTGAGCGGTTATTTTTAGAG
CTGATCGGTGATTACTGCGGTGGAATGATTAGGCTGTGGGTGGGTTCCTCGTGGCGGAAGTGAGCTTCACCTTCTCGCTCGGCGTATGCATCTTGGGCGA
CGTACCGCCTGAGGATCTGATCGACCAGGAGAAACCTCCAGTGGTGGCCGACACGCTGGACTCTTATGGTAACGCTGTTAATTCTGAACGCCAATCGTTA
TTGGACGGTACGTTGGGCCTGGAGACGGCCAACGGGGGGACAAACTTCACTGATCGATTTTTTGTTGCTCTTGTAGAGGCGGAGCGCGCGGTGCCGAGCT
CCGACGTGTATGTGCCGCATAGTCAGCGACTTTGGAAACAGCGATGCACGCGCTGCTGCATGTGCTTGCGCTGCTTCACGTGCAACTTGTTCGGAGGCGC
TGGAACTCGCCACGACAGCATGTCCGTGGTGGCAAAGGTGTTCTCGAGGCTCTTCTATGGTAGTCCAGATCTTGTGATATCAGATATTGTTGCAGGTTTT
GTACTGTTGGCTGCGGTTCAGGCGTACGAAGACCATCACGAGGTCGTCGCCACGTCCCCACACAGAGAAGGAGACGAAGAAGAGGAAGAAACACTGGGGA
AATTACGTGCTCGAATTCGCGCTAGCACGAGCAAGATGAATTTACTGGGCGACCGCGCTGCGGCTGCTGGAACCATCACAACTTCGA