Description :
From Genome Similarity Track
Location :
Scaffold_424:1037- 7462
Transcript NameFunction/comments
g15283.t1hypothetical protein
g15284.t1hypothetical protein

Sequence
6425 bases(100 bases per row)
GGTGAGCGACTCGGTTGGTGGTCATCGAGGAAGTTCGATCGCCGAGTACGAATGCGAGCTCTTGTTATGGGAGCTGTGAATGATGAACGAACCAAGATAT
TGTTGGATACTGGAGCAAATGTCTCCGCAGTAACTGAAGCCTTTGCAAAGAGGCTACGGTTGAAGCGATTGACCAGCCTGGATAAGAGAATCGATGTTCA
AGGAATTGCGAAGTCCAAAGTGGTGACTACTTCTCGAGCAATGGTTAAAATCACGCTGGGATGGGAAGTAGCTTACGAATTCGAGGTGTGGATTATGCCC
CACCACGCAGGGGTGGACCTGATCCTGGGCACCGACTTCATGATACCAGCTGGTATTAGGTTGGACCTGTACAACTCAACGGCAAAGCTTCCTGATGAGG
TTGTAGTTCCTTTGATCAAGTCGTCGAGAGATTTCGACGAGACAGAGTACGGGCGCGAAGTAATCGGTGGTCCTCCGGAGTCATTAGATATTACAAGCCG
AGCTATCGCCCAGTTCAAGCTTCGACGGAGGCAACCCAGCGAGTCAACTCACGAACTGTGGGTTCGACAGATGAAGGGGGTGATCCCGACGATCGAACAT
AATGCGAAGGGACGAGCAGTGCGAGTGTTGCTGACGAATATCTCGTCGAGACTCACGTGGTGTCCTGCTCACTTTCCGGTGATCATGTGGATTCCTCACG
GAGTATTACCACGGGACGAAGGGTATGTGCGAGTGAACTCAGCGAAATATCGTGATTGGCAAATACTTGCCTACGAAGGCGCTCTCGACAACAGGCTTCT
CAAGCGAGAGCAGCGCTTGTATATGGAATGGCTGAGTCGGCAACCCCCCGCAGTCGAGCAACATCATTACAAAACTCCCAAAGCGATTCAGAAACGGTCG
AGTCGCAGCGAGTTCGCGGATGAAGCAGGAGTACACGCACCAGAAGAACTCAGCGAGGCCCCAGACTATCAAGGGAGTTCCGCGCTTGCTGACTACGGAA
AAGAAATTGATGACTCGGCGAATATACCAAAGTTGGACCCAGCGGAAGTTCACGATGATTCGCCCCTCAGTGAACCCAGAACAGACTCAGCGAGTTGGAA
TCCGGGACTCTACCCGGTCAATCGCAAACAAAGTTCGCTGAGTCTCACTGATGAACCACCGAAGCTAACAGTAGCTACAGCCGATGGAAATATTGAAGAA
GAGCACGTGGTAAATCACGAACACCCTATAGTTCGTTCGTCTTCAAGCAATGATACACAAGAAAAGTATTCCAACGAGATGGACAGGGGTGACCAATGGG
ACCCGGGCGAATCCAACTCGAGCAACTCGATGAGGGAGAGTAAACCACAGTTACCATCTGAGGACGATGTTCAACAAGAAAAGACCGCTCAACAAACACT
CGATAGCGGCAAACAATGTCTCATCGACTGTGGAGGGGTAGACATCGCTGACGACCCTGTCGAAAATCTCCGGTTACGATTCCTCAATGTAGTGAATGCT
ACCGAAGCGTCTGTATCAACGACCTCTGGTCCAGATGATGACACACGGCTCGCTGAGTTTGAACACTCGTCGAGCGACGAGAGTCTGACAGATTACGCGC
ACGAGTTGGCCTTCTTGCCCGATCTGACGGATGTCCAACCAACCGACCTCGATTATGACGGTGATAACGTTGTGTCGTCAGCGCATGACGCTGAGCAGAG
AAGACAACTCATCACCACCCTGAAACGGCATGAAGCGATAATGATTTCTAGTGGAAACGCACTCCCACCTCCAGCATACGGAGTAGTATGTGATATTGAC
GTCCAAGGACATGAACCGATCAAGCAACGAGCTCGGCGAGTGCCACTAAAGAACCTGAGTAAACTATACGAGCTCTTAAAGGCACTGCTGAAAGCCGGAC
TGGTGTCGTTCTCGAAGAGCCCATGGGCATCACCCATCGTGATAGTGATGAAAAAGAACGGAGTCGACATTCGTCTATGCATCGACTACAAGATGGTGAA
CGCCATTACAGTCAACATGGAATATGCTATGCCACTCGTCGATGACCTCCTTACGGAGCTGGAAAGCTATCTCTGGTTTTGTTCGCTGGATGCAGCGAGT
GGATTCTGGGCGGTGATGATGACTCGGCGAGCCCGAGAAATATCCGCCTTCGTTTGCGCTCTGGGCCATTTCGAGTGGCTGCGCATGCCGTTCGGCCTAA
AAAATGCGCCAATGATCTATCAACGACTCATCGATAATGCCCTTTGGGGGTACGTACAACCGAGGGGTGGATGGACTGCATTTGCCGAGAACATGCAACG
AGCGGAAACAGCAGCAACAGCTCAGCGAGCGCAGCGACCAACTCGCCTATTCCGAAGTAATGATTCACCCTGCCACGGGGCTAAATTTGAAGCTGATTAT
CGTGCCCTCGCTGAGACAGACTCACTCCAGGAACTCATAAACAGCCCCGAGGGTGACATGTTTAGCACCGGCGAGCCCGACGAGTCCGAACTCATACCCG
TTTTCGGCCGGAGATCGTTCGTAGACGACATTTGTTTCGGTGGTACTACCTTCGATGAGTGTCTAGCCACACTTGATCGCTTACTGACAAGATTCGCTGA
GTGCCGAATAAGTGTGAGCTTTACGAAGAGCATATTCGTTCAGCAGAAGGTGGACTTCCTGTCCCACAAAGTGACAGCCGACGGGATCGCAGCTGACCCG
AAGAAGCTGGCAGCTATCGCTGAACTACCATTTCCGAAAACGAAGAAAGGCATGCAAGCCTTCCTTGGGGCATTGAACTATTACAGCCGTTTTATTCAAA
ACATGGCACTATATGGAGCAGTCCTCTATCAGCTCAAGGAAGACGATTTCAGTGACGAAAGTCAGCTGACAGCTGCCAAAACATCTTTCGCTGAGTTAAA
ACGGAAAGTGTCTGAAGCACCGATACTGCGACACTTCGACTCGACGAAGGACGTCCACGTCATGGTCTTCGCTAACGCCTGGGCACTAAGCAGTACAATG
ATGCAGTTCCACGACAACAAATTCCACCCCGTTAGATTTTGCGGTCGCGTGCTGAAAGAGAATGAAGCGAACTACACGCCAGCAGAGAAGGAAGTACTGA
CATTGTTACAGTTACTCAAAATATGCTACACGCTAGTCGCTGGGAAAACCATCCATGTCTACACGAGGTTTTCGACGCTAGAATGGTTATTCTCATCAAA
AACATTATACGGGCGCGCTGTGAGTTTTGCCGTCCTGCTGTCACCCTACCATTTGAAGATCAAGCGTGTACGTGAACGAGACGTCGAATTCGCTCAGCTT
TTACAAGCTTCGATTACTCCTTTCATTGGACTCGACGAGTCACTAGCTCACATTGCACCCATACCTAAGAACTCGGCGAGTATCCGAATGGATCCCGAGT
TGCTATACGCGCGCGTGCCGCGCGACTTCGACGGACACGTTCTGTCTTTCGATGGGTCTGCAAAGACCGAGAAATACGGCGGTTATGGAAGTTGTTCGTG
GATCTTGTGGCGTTTACCGAATTGGGACATTGTGATCGCTGCGAGTGCTCACCTGCCGTCAACGACAGTTAATATCGCTGAGTACACCGGGATGAACCAC
GGAGTCCTCGCGGCACTGGAACGAGGGGTGACTGACCTGATCGTGGTGGGCGACTCCAGGCTCGCAATCCAGCAATCCATGGGGGTGATAGCATGCAAGA
AGGAGACCCTGCAAAGGGAATTAGCACGCCACAAAGAACTCGTCGAACGCCTGAATTCAGTCCGCTACCTACATGTAGTCCGTTGCTATAACTCGGCCGC
AGATGCATTAGCCACTGAAGCTCTTGAAGCCATGGCAGGACGCGTTGTCCTCAGTGGAGATCGAAAAGCAGAGCTGCGAACGCTAAACAGAATCCAAGAG
AAGTTGTATGCCGTCACAGACTTAACCGAAGGAGAAGAGATTCCTAAAGTCTCGGCAACCACACGAAGCCAAGCCCATCAAACTCGCCGAGTCAGATTCG
CCGAGGACGAACTAAATGACTCAGCGAATGAACCAACAACGCCAGTAGCGTTAAGAAGAAACGACTCGCCAAGGCTCACCGATGACAGCGATAAATACGA
AGAGTTCGAAGCAATGTACAAGCCTCCAGGAACTCAAAGAGTGATTGAACAAGGTCACACTACAATTGAGCAACAAGAGCCACCAAGCGCCCATAACATT
GACCCGTTAGCCGTTCAGACAGAACGGCGGGAACGAATATCGGCCGCACAAGACGAAGAATGCAAGTGGTCAGACCTAAAACAATACCTACGAGGTGAAT
TCGACGAGCTCACTCGACGAAGAGCTGGAAATGCAGGCAAAGTTGCTGACCGATTCGTGCTCAGCGAAGATGGCCTACTGTACTTTCTGGGTCGCCGACG
AGAGCGAAAAGAACCCAGCGAAGAAGATATGAAGCTGAGACTAGTAGTTCCGACAACGCTCATCGACGAAATCCTAGCGAATTGTCACAACTCCATCGAG
GGTGGACACCAAGGAATCGTGAGAACGTATCACAGGGTGAAGACAGACTACTATTGGATTGGGTTGTATGCCGATGTGGTCAAGCATGTCCAAGCATGTG
AAGACTGCAATACCAGCAAGAGTAAACCCCACTTGCGAGGATATTCGCCAGGTAACGTAGTATCAGACAGACCATTCCAGATCGTGTCCATGGATTTCGT
TATTCCATTACCAAAGACTCAGCGAGGAAACACTGCACTGCTTCTCTTCCAGGATCACTTTACTGGATTTGTGATCGCCAAGGCAATGAGCGACACAGGG
GCACTTGAAGTGGCAAAGGCATTTGAAGAATGCATTTTTCGTCGGTTCGGAGCTCCTTCGCTCATTCGACATGATAGAGATCCAAGGTTCATGAGCGAAG
TCTTCCAGACGTTTTCTGAGATGATGCAGTCTAGGTCACGAGCCACCCTGAGTTATCGACCTCAAGCAAATGGTCAACAAGAGCGTAGCGTCAAGACGAT
GATCCAGACAGTACGAGTCTACGTAGAGGACCCGTTACAAGCTGATTGGGATGACATCGCAGAAAAACTCGTCCACGCTATCAACAACTCAAGAGATTCG
ACTCGGCGAGAAACGCCATTTTACTTGGTACACGGCTGGGATGCTCAGTCTACATTAAAATCGATGACTTCATCCATTCGCCGAGCCTCAAAAGGCCCAG
CGAAACAGACAACGTCAGCAAACGCTATAGAATGGCGCAGAGAAGCAAACCGGCAGCGAGAGATCGCGCTCATTCTTGCCAAAGAATACCAACTGAAAGA
AAAAGCCCGGCGAGCCAAAGAGCATAACGAATCGTTGAGCCGAGCGGAACAAGGAGCTGTTCCTTCAACGAGTAACGAAGACAATGGACAATTAGCCAAG
ACAAACTCAGCGAGAGATGACACAGCAACTGCAAGCGCGAACGAAGAATTAGCTGAGTCCGTGCGGTCCCTATTCAAAGAAGGAGACCAAGTCTGGTTGT
TCATGGAACGGGTGAAACCCGGATTGAAGAAGAAACTTGCACACCGATGGCACGGACCTTTCCGGGTCAAGCATAAGGTAGAAGAATTCGCGTACGAGCT
AGAACTGCCGGACAAGAGCGGTTATCGATTCTACCCCGTGGTTCATGTATCACGGCTGAAGAAGGTGACTGAGCTCAGCGAACGTCCCACGACTCAGCTA
GTAGATGGTCTCAGCGAAAACGATCGATTTGACTTTGACGAGGAGTTGTTGCCGGAAGACAGCTGGGAACCTGACGAACGAACTGGGCGATATGAAGTAG
AAGCCATTCTCGATGATGAAATGCCGCTTTCGACGAGTACCGACCGAACTCAGCGTCTGTTCAAAGTAAAATGGGTGGGATATGATGAACCCACGTGGGA
ACCCTTGTCGAATTTATCGTGCGGAGGCCTTCTGTTCGATTACCTTCGCCAGAAGAAACGTGAAAACCGTCTGCAAATGGTGCAAGTTGCAGACGAGTGT
TAAAGGCTATTGCATACGAAGATTGACTACCAACCTGTGAAGACAGCAGGCAGGTTGGAGGGATGGAAATGCTACTGCGTCATTGCATAAATTGATATTA
CGAAATGGATGACGTATGGATTACGAAGAAACAAGAAAGAACCACCAAGACTCATCGAAATCAGCGACTAAAAGAACCTGAGCCTTGGCGATAAGAGACA
ACTCATCGATGAAGAACACCAGACGAAGTCTGCGACTCGACGACCTACGACTCGTCGAAAATACCTTCAAATATGCGAATGTCCGCGCGATTAGCGGGAG
GAGCCGCACTCCCGTCGACAAATGGAGGGCCTGGTTCATTGGGATCCACGTCCTCCTCGAGATCAAGCTCGATCTCACCGATCGAAATACCCTCGGGGGC
GAACATAGGGAATTCGGGATTACGC