Description :
From Genome Similarity Track
Location :
Scaffold_129:103674- 105230
Transcript NameFunction/comments
Phyci_32114glycoside hydrolase, putative

Sequence
1556 bases(100 bases per row)
GAGAATTGCTCCGAGTACTTGACTCCCACGTCGACGGGGCCACTTGAGACTTCAGATAGTACGAAGTACGGCAGTCCCTCCACCTCGTAGCCATAGTCGA
GCGTCTGCTGCGGTGAGTGTGAATCCACTGGCGTAGTCGCTTGACCCCATCGTCGGTGCTATGCCGAGCGCAAGCTTCTTGGGCATAAATACCCCATAGT
CGGTGGTTtgtagtaggtctgagcgaaactctgctacggaagccagcgcttcctggtaagtccctcagtatattgagttcaagtaggtaaaatctaatgt
acgctactgttcggctcggtccgtcggccgacagtagtttcctaaCTGCTCTGTCGTTTGTCAGCTCGGCATCGCATCGTGTGTGATGCCCAGTAAGTGG
GAAAAGACTTGCTACAGTACCCCCTCCCCCACTACACTGCCCTCCAAAGCCTTGACCACTCTCTAGGCCTCCTTAGCTTGTCATGGTACGCTTCCTACGT
GCCTTGCTCTTACCCTCTTTGTTCACATGCAGCACGAATTTCTGATCCTTCGTGTCCACTGCATACTGCTGCGGCAACACACCGGAATGTCTTTGCGTag
ctgttgggtcggttcccacgagtcttcgatcgactcgaggtccctccagctagctaatacgtcatagtccttcttgtcgcggctccagcggtagtcattt
aacttggacaccgtcagcgccatgccgtgagcaccaatgtgttcgagcagatcctccgtaacttctaaggagctgtctgcgtaatacttaagtcgtgacg
ggtggacgtccatttccttccccgtcagcaggtgtcgaacaccgaatgagtgcttgtcggctcgtaccacctggtacggcccgacccaggtgaccaacac
tttgtcatagtacttctggtcgactctcgaccttaacgcgtagtcgccgacggcgaagttcggccgacgtgcgcacttctgcattttttattgcgcactg
tctgttgggcttgtgccaccgtcatgggtttgtgcaTCTCACGGATGCTGGTCCGCcagggatggcaaaaaaaatatttaaatatttttatccgtgaaaa
aaatataataaaatattttttcattttaattcgtgtaagtacgaaaataaaacacttcggttttgtatcggacacaatctgacaaccgcgctctattagg
tggggccctatatttgctgacgtgcgacgcagtcatctcgccgtccttgcacacgcggaaggtggggaagcagtccacatcaatctccttgcagacgcct
cggtgttcacctttaggaacttgacggccaggaactcgttctccgtcagctgcgtcaccttggggggtcaccatcttgcagccaccgcaccgcggcgccg
agaactgcacggtggccggctgcttctcgccgatggcgccgctgaagtcctcaggtgtcttgacctcgatcggcatggtcggctccgccacctatgaagc
tgaagtagccttgcggtggcagcccactcgtcagtatgcgttaaggccagtattca