Description :
From Genome Similarity Track
Location :
Scaffold_9:1036622- 1038683
Sequence
2061 bases(100 bases per row)
GTCAAGATCGGACGAAAAGGCCCGCCGATCCACCCGCAGATGCAGGCTCGAGACCTCACGCTCCAATATGTCGAGGCGGCCCGCAAGACGAGCGAGCTCG
CCCTAATTCCCGGCCTGGGCGGCAGCATCCCAGCCTGTCCCAAGGTCAAGTGCAATCTCAAGCACGAGGACGCATTAACGAAGGTGGCCAGCCTCAGGTC
CCTGCGTCGGCCCGCAGAAGAAGCGCTCGGACGGGAGTAGCGTCTGGGAGGCGCCGAGTACAGCACAAATTTCAGATAATACTTTAAATAATGTACTCGT
ACGAGAGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGGCCACTACCATGTAACGCGAGCCCTCCAGGACCACCACGACGTCGGGCTAAGCGACAGAT
CCTCGTGAAGTGGAGAACTCGTGGGAGCCGACTGAACGGCTCGTGATTGATTGATCGAAGGCTGTCACAATCTGGGAACATACGCGGCGGCAGCTTCATA
ACCAGTCCGGGGTTTCTTGCCCAAACGGGGTACGGACGCTGGCGACACTCCGTACCCGCGCTCATCGGGAGCGCTAGAAGCTGCGCACTTCAGAATGGCC
TTTGGCAGTATGAACTTGCTGACCAAGTGGGCGAACCGAACACAAAAATCACGCTAGTCCAGGATGCGGGACGGCAGCTGATCTTCATGGAGTTCCCGAA
ACTCCGAGGGTGAGTACTTATGAGGCTACACCTAAGCCCGAACATGTCCTCACATGAGGTCCAGTTGGGACCATTCTCGGGAAGGGCCCAGGGATAGCCC
CAGAGAGGGTAGAGACCACCCCGGTTCTCGGGCTTCTTACGACAGGTCGTGAAGTCCTTTAGAGGGATTCGGTGCGGCGCGAGAAGCACACAATGGGCCG
CCTCCAAGTTGTCGACAAACAACTGCTCCTTCTAGACCAGGTTACGTTAGTAAATGCCCTTAGAAATGTGGTCTCCACTTATGCCATGAGGAGCGACGAG
AATCTCCAAGAAGAGGTCAGCCTCAGCGCTCTCCTCGGGAGGCCAATTCGCTCTTGAGTTGTTGGCAGCTCCCTCGCCGACGGGTGCCACCATCGGACTT
CCACGCGTGCGCTGGGCAGCTTGGAAGTCCCCCTGCTGCTGGTCGATGATATCTCGGGGCTTCGGGATGACATCCTCCTGTTCCTCGTCATCCAAGGAAC
CAAGGAGGCTCCTATAGAAGTACCCAGTCTCCTTCTCCTCGCGGAGTGGACACTTTGAAGCCGTACGCGTCTTAGATGGATCGGCACCTTCTGCTTTCGC
GGCCTTAGCACGCGCAAGCCCCTCGCCAAGCGAGAGACGTTTGCGAGGTTTTTCATCCTCCTCGTCGTCATCTTGGGGAGTGCCCTTAGCCTTGGCAGCC
GGGCTCTCAGAGCGCACAGACGTACTGGAACTGTGATCATCGTGATCACTAGCGAGCGACTGCATGCTGTCGTCTTTGCGCTCGCTGAACACTGGGTTGG
GTCATCCCGTAGAGCCCACAGGATCATCGTGCGTGCTTCCGGACACGGCTTCGTCCTCACTGTCCGAGTCGAACTCACGTTCAGCGAAACGGGGGCTCGG
ACGGTTGTCTGGGGAGGCCGAGGGTGACGGACTGCGGCGCTTTCTCGCACGCTTGCCCACAGCCGCGTCATCAGTTGAGCCGATCGCCTCGGAGGCCACC
TTAGTAGCCTCCTGGAGTGCCGATCCTTTGCCGTGAGGCTTAGTACTCTTGGCTTGCGCCTTTCCGGTAGCAGCCCTGGGGCGTGTCTTCGCACCGCGCT
TTGCAGTGCCCCAAGGCATGAAAACGGTCGATGTGGAAACCTAGAAGAAGAGCGCTCAACCGCTGCTCGAGGTTCTAACTGTGAAATGAGCCTCCGCCGC
GCTCGCGCGGCCAAGTCGATGTATTTCGTCTTTGAGAATGATAGTTTGTGACGTACACTTCTTCATTTTGATTGGTCGGTAAACCGAACCTAAGTGGGGG
AGGATGTAATATGGGTACGTAACCCTAAGTGTACCCTAGTTACATGACGTATAACACGTCA