Description :
From Genome Similarity Track
Location :
Scaffold_817:10364- 12388
Transcript NameFunction/comments
Phyag_g8195hypothetical protein

Sequence
2024 bases(100 bases per row)
GACGCCCACGGCTACGTCAAGACACGGACGTACGTCAAGGGCAAGTTCCTGGGCAAGGTGCAGTGGTTTTGAGCCGTTGTTGTAGTTTTTTAGGGTGATT
TTTGATGAGTTTATGCTGTTTTTTTTGCTTTTTTAAGGGAGGTTTTGCACGTTGCTACGAGTTAAAATGCGAGCAAACAGGGAAGATTTATGCTGGAaaa
gtggtggccaagaGCTCGTTGATTAAAcccaaggccaagcagaaaGTGAGGGAGCTTTTGATGTGGAAGCTGAGAGGGAGGAGGACaagtgctgatgctg
tgtACTTTCTcggatttttttttattctAGTTTACGTCGGAGATCAAGATCCACAAGTCGCTGCATCACGCGCAAGTTGTACAGTTTGAACATTTTTTTG
AAGACTCGGACAACGCGTACATTTTGCTGGAACTGTGTCGCAACCAGTCCATGTCGGATTTGATGCGAAGGAGGAAGCGGCTGTCCGAGAGCGAAGTGCG
ATTTTACATGCGGCAGCTGGTGGAGGGGCTGGCGTATCTGCACGAGAATTTGGTGATCCATCGCGATCTCAAGTTGGGGAATTTGTTCCTTACGTCGGAT
ATGAGGGTCAAGATTGGGGATTTTGGACTCGCCACGAGACTTGATAACCCCGAGGATCGGAAACGGACCATGTGCGGCACGCCCAACTACATCGCACCGG
AAATTTTGAGTGGCCAGCACGGCAACGGACACAGTTTTGAGGTCGATATTTGGTCGACCGGTGTTGTCATGTATACTTTGCTGGTCGGACGACCACCGTT
CGAGACGGATGATGTTAAGGCTACGTACAAGCGGATCCGGGCGAACCAATATGAATTTCCAGAGACTGCGCACGTGTCCCGCTCGGCCCAATCGCTTGTT
CGTGGTATCCTGCGCAGTGACCCGGGCGCAAGACCGTCGCTTGAGCAGATTTTGAAACACCCGTTCTTGGCTGACGAGTTCGTACCGACAACTCTCCCCA
GAACAGCACTGCTTGTGACCCCGCCATCATGTAAGGATCAATCCTTCGCAACCCGTCACAGTGCCAGCGAGCGGTTTGCAAGCTCAACTGGAGTAAGGGT
CCCGCCTCcgccggcagcagcgacaaggtATCCTCTCAAAGCTCGAGATGTGAATACCCACGCTCAACGTGCCTCTGATCCTGGGGTTTCGCCGTCTCTG
GAGCAGTCATTGCCTCCTGCAGATAAGCGTGATGGCTCAGGGAGAACGTCAGGTTTTTCTAGTACCCGAAGGCAGTTAGCtactaccagcagcagcacta
caGCGAAGAGTACCGAAAAAACAGAGGTGTCGGCTCCATCGCAAAATGTACTGGAAGCAGCCTACAAGTCACTGTCTCGGTTCTTTTACCTTCAAGAACA
CAGTCGCACTGGGGGGGACAAGAAATTGAGTGAGTTGTCATCTGCTGCCAccattgttgctgcggcACAGAAATTAAAGGAAATCCGAGCTGAAGCAGAG
GAGGTCTGTTCTCTTGTACCTGTTACCCTGTGGATATCTCAATGGGTCGATTATACGTCCAAGTACGGCATCGGCTATATGCTTTCGAATGGCGGATCGG
GTGTGTACTTTAACGACTCCACCAAGATGATTTCGTCAGCTGATGGACGAGTATTCGAGTACATTGAACGTCAAAGCAGCCACAGCTCAGGACCAGAACC
TCGAGTCCTCTGCACCATGGACAGCTACGATCCGGCGCTCAACAAAAAGGTGACATTACTAGGTCACTTCAAAGGTTATTTAGTGGACGCCCGCGCAGAG
AACGACGAAGCGGATATCCTCGAAAATCAGCTTGCTCGGTCTTTTGTGTTATCATCCCGTGAAGTTGGCATGAACACCAGTGGGCTTGGGGCCtgcagtg
atgatgaagaagcccgGTCAATGGTGTTCGTGAAAAAGTGGGTCAAGACTCGTCACGCCGTACTGTTCCAACTCTCCAACGGGACAATTCAGTTCAACTT
TTTCGACAAGTCAAAGCTCATGCT