Description :
From Genome Similarity Track
Location :
scaffold_100:10363- 11495
Transcript NameFunction/comments
Pl_109758hypothetical protein PHYSODRAFT_391055

Sequence
1132 bases(100 bases per row)
GTGGCGACGACTTCTGAGTACGACGAAGCAGCGCCTTCACAGCGTCATCTGAGCAGCCGCTTACGATGCGAGTGAGTGCACCACGCTGGCCCACACGCGC
AAAGCTCTGTGCAAGAGCCTCGCTCTGCCAGTCCTGATATGGTTCACATGAAGTTGTGAATACGAAATGCAGCTCATCACTTCCTTCTTGGCCAGGCTTG
AGATCGCTTTCGTGGGGAACACCAGGGGTTCTCTTCCTCTTGTAATTCCCAAAGTAGACGGGTGGTTCCTCCTCCATATCAGTGCCCTCTGCAAGTGCGA
CAGCGGTGCTCTGTGCCTTCTTATTAAACTCCATAGGAATACGGCGATTACGATTGAAACCAGTAGGGCACATATGAGAGCGGTAATTTTCAGACGCACT
ATTGTAGGCCTCCACAGCAAGACACACACTCATGGTGTGGCGACGTCGAAGAATGTTGGGAACACGCTCATACCCGTTCGTGTGGGTAGCAAGGTACCAC
AGATAACCAGTCGGCTGGTGAACCATCCAGGCATCGCACGAAAGGAAATCCGACGGAATTTGATCAGAGAAGAAACTCCAGTCGCGACCGTCAATCCATT
GAGGTAGAGTAAAATTAAGTGCACGGATAGAAATCGGGTAGGACGACAATGCCAAGTTCTTTCCTTCAGCCCGTTCTTCACAAGGATTGTGTTTGATATC
ATCCACAAAATCCCAGTTTTGGTAGCGAGAAGGATAGTGGTGCACGCTAAGCACACCGGAAACACCAATAGGCATCTTCTCGTGAGCTGCAGCGATAGGG
ACTGCCAAATAACGCTGCTCATGCGCCAGCTTGCTCCACAGATCCACAGCAGTAGGCAGAATCACCTGCCACGCGCTAACTTCGGCAATAAACGGCGCAA
TAGCAGCAAACTCTCGCCAGTCATCCAGAAGCAGCGCGCGTGAGTTCGTCGGCACGATCCTCTTTAATTGATCTTCCGTGAGAGGGAATCGGTTGGGCCA
GTACCACGATGCATCCTGTCCGAAGATACGAGGGTCGATAACGTCACTCGCTTCCGCCATGAGGTTCCACATATCCAACTTCTTGGTGAAGATCGCGTCG
CTGTCCACCGCCATGACGAAATCATCAGATTT