Description :
From Genome Similarity Track
Location :
contig_38:103576- 126317
Transcript NameFunction/comments
g8322.t1hypothetical protein
g8323.t1POM58271.1 Lipin-like protein [Phytophthora palmivora var. palmivora
g8324.t1hypothetical protein
g8325.t1RAW30488.1 hypothetical protein PC110_g13154 [Phytophthora cactorum
g8326.t1RAW30491.1 hypothetical protein PC110_g13153 [Phytophthora cactorum

Sequence
22741 bases(100 bases per row)
GGCATCGGTATGGCAGCTATTGATTCGAGCTGGTGAAGCAAGCAACAAAACGGATAATGATTTAGAGGTAGTAATGGCTTGCTTCACGAGCTACCTGCAG
CAGTGTGTCACCATGAATATTCGTGACGAAGACCGTCTCCTTTTCAGATTTCTGCTGGCTTTTCGTATATGGCAGCGACGCATGGTGGATGAAAGCTCAC
CGTCACCTCGTTTAGCGACATCTGAAAGTAGCGCACAAAGCTGGCGTTCCACTGACATGGAATTATTAGCACGTTTGCTAGCATTGGTTAGCTGTAAATC
TGACCACAATTCCCATGATACCTGCCGACCAACGCTGAAACGTTTACTTGCACTTCGTCCTGCCGGCATGAAATCTATTGCTTGGTCTGCGGTCTGCTAT
TTAGCAGAGGCATCTGGGGCTCTCGACAATTTATCTCGAAAATGGAGAGTGTGGAAGCTGGGCAAATTGTGTGGAAATCGCTGCTCGAGCTGGGAACAAG
TAGTTCAGCTGATTGGGCTGTGCACATTTCCCTTGACGCCTTTACTCGTTTGTGTGTCGTTGTAGCTGTCCATCCGCATCGATTTTTGTGCGAGCTTGAG
GACTTCGCCGAGCGAGAACTACAACGAATTTACAGTTTTCCCGCGACGTCAACACAATCAAGTACGAATATGAATCTACCGTCACTTTCTTCTGTGGTGG
CCGCAGCATCACACTCATCAATGACTCAAGCCCCCGACTGGCATCGTGATTTATTCTGCATGTGGCAAACATGTTCAAGTGCAAAAGCCCCGCTGGTAGT
ATTTTGCCCACCAAACATTGATTTTATGGATGCGGTAACAAATGTGGCGAGGCGTGCTGGGGCAACGATGGATACGACAGACACTATCCAGCTACTGCTT
GCCGACGAATCCACTTTCAAGAAAATACTGCTACTAGCTATGGAGAAGGGTCAGTGGGTAGTACTTCCAAATGTACACACATGCCTCAACCAAATGGAGC
AAGTGAGCAGTATTTATGAATCATTGGACGATGGGCACGCTCACTCGGATTTCCGTTTATGGATATCAGTGTCAAAACAATCCGTTGAAGATCCTGCAAA
GTGGCAAGCTGATTTTGAAAACAGGAGGATTAATCGAATTGCTACACGACGAGAATGGGGAACTGGGTTTCTTTCATTAAAGCGGAGCCTACACCACACA
TTTGCAATTTTGAAGCATGAGCTCGATGGTTTGTATGTTCAAGCACCGTTCCAACGCTCCCTACCTTGACGTCAGCAGGTGCTTCGAGATTGAGTGAACA
CGAAGAGAAAATCATGAAGCAACTCGGTGTTTTTCATGCACTTGTCTCGTGTCGTGACCATTTTCAATTTGCACAGTGGAAAGCAGAAGAAGAATTTGGG
GATACAGAATTGTATGCTGCAATTCGCTCTTTAGTGGTTCTACGAACAGATGAAGAGCTGTAATGAAGGAACCGAGTCCTCTGTGTGCGCCCAGCATAGG
AATGTGGAATGAAGTGACACTGCGTGGAGTTATCTCTAATGTCTATGGATCAACACTAGAATCACGGCAAGATCAACTGCTGGCTCAATCCTGTATTGAT
TTTGTGCTTAGCACATGGCCAGAATTGCAAAATGAACACGAACTTGATGCTACAGCAATTATAGGTCGAATGGCCTACCGGAAGCTGTGCTTGTTATCGA
AAAGCTGGCCACTATCCCATGGATGTCAATCGTAAGCGCCATCTCCCACCTTTGGATAAGTGAATCTTGCGGACCGTCTGCACTGACAAGTGGTGGATCA
CCATTAGACGGTATATCGATATGGGATCCTCAAAACATGCGCAGAAACCGACAGAAGAAAATCACCACGCAATTAGCAGTCCTGGTAGAAAGCAGAGGAT
GTCAGCTGCATACTCGATTACTACCTGGGCGCTCACTTCGCAATATGGAAGTGCTCCCACTGCTCGAGCTTCTCGCTGAATTTGGAAAGAATCTCGAAGG
TGTTGTATTGCCGTCCTCGTTGGGTGATGAGTACGAGTATCGTAAACCGATTTCGGCTCTTGTTAACCATGAAAGACAGGTGCTTGAGCAGATACGAGCG
GTGATTATATGTGATATTAGGAAATTGGAAACGGTATGTTATCCATTCTACTGCTTTCACTGCGATCACTGATATCTAACTTTTTGTTCTGACGCAGGTC
GGCTTTCGGGGTCGTTTTCTTGATTCAGCTACGCAGCAGATATACAATGAACTACGACACAATAGAGTTCCCGCTAGTTGGCTCGCACTACTTCGTCTAA
ACACCGGTGGGCCGCAAAAGTGGAGCTTCGACAACTTTCAAAAGCTTTTGCTCGATCGACTTAACACGTTCGCGGCTTGGATGGAACCGGACGATGGTTC
ATACAAGCTGCATCTGGATAAATTCGAGGAGCCTAAGGTGAGTTGTATTTTATGCAATTTGAGGCCAATCATGCTACAGATATTCTGACGATACCTTGTT
CAAATATTTTTCTGTGTGTGGAAAGCATGTTTTTGAGGCTGTTCATCAGCATTTCGTCCGTAACCTCGTGGGCAATGCAATGTGCTATCCTGACTGTTTG
AAGGTTATCTCGTTATTCGAGGATTCTCCGAAACTCACACTGCCGATGAAAGAAGATGTCATATACCTCACTGGTGTTCGAGCTATGGGCCATTTACAGC
TTCAGGTTATTGATACCAAGGGCCATCTCCGTCGCGCTCCCATAGCTCCTTACGGGGTTCCCGTGATCCTACAAGTAACCAGTTCATGTTTATCAGACAT
GCGTGGAATCTCCGTATCGCCAAAGAGGCCTACTAGCGCGACATTAGAGACGAGTAATGATGGTGACAAGACAAAAGCTGAACCGACCAACCATTCAAGT
GGGACACGAGAATTCCTGTGCCCATTGTTCACACTTTCAGGTGGGTCTGATTTGGCAAACGTGCCGAGGCCAGTATCCGTGTGGTTAGCGCGCTGCCCAT
TGCACAACTCGTTTTCAGTGGAGCCAGCTTGGAGCTTCAGACTGTCGAGTAGAGCAAACATTAAGATGAATCCTAACACCGGCATGTATGTAAGTTAAAC
GTCGAACGCAATCGCGTTTGATACTATTTTGCTTTGCCGGAGTAGAGTTGTCGAGTGAAACGTATAACTAATGGGATATCCGCCTTGCGCATGATTTTTT
CGCGGCCATTGGAGTTGTCCAACCACTGAAGAAGCCCTGTGATCTGCTGTTCAGGTGTTTCGTAACCAGGTTTCGAACTGAAGAGCTCTAATGCAAGCCG
GGCCAATATCATTCCAAACCCCACCTTCTTTAGTGTCTCGGCGTCGGCACCACTTGGTGGGTCCTTGTCATGTATTGCAAAATAGACCTTGAGCAATCCT
GCTACCTCAGTATGCAAGCGTTTCAGGCTCACACGATCCATGAATGACGGGATGAGCTCAAAGTCGATCGCGAAGCTGAGCACGAGATCAAAACTCAACC
CGAAGAGTTCGGTTTTGGTCGTCGAGATTGCAGCTGTAGCAGTAGCGTTGGGAAAATGCTGAGAACTATAGAATTCACAAATTGCACCAAGCGGTCGCTC
TTCTCGGCTTAGAACCCCGTTCATTTCCAGCATGGAGATACTACGTCTTCGCGTTTGTGAGAACAGCCGATGGAAGGTGGAGGGTACAAATGCCAACGTG
TTTCACCGTCCTGGACGCCTGAGCTCTTAGAATTTCGAAGGAGTTCGTTTTCGTTGCCGTGACCCAAGTGGAGAGCCAAGCCAGTGAGAATGCTTTTCAT
CGCTCGACTGAACACCTGCGAAGGCGAACCAACACTGGCCCTTCGCCTGACACCACAGGAAGAAGGTGATCTGCTACGTTGGTTTGTTGAAGATTGGCAT
AGAGTTAGCTGCTGTCGAATGTATGGCCGCAAATACAGTGCCACTACTGTCTGGAGTACACGTAGTAAATCGATCGTGGGAATCTGCGCATGCCAATCAA
TGTTACTGCCTCGTTGAATGCATCCATGTTGAAAAATCTATAGCGCGTGGTATCACCGGCAGGGTTCATTGATTTTGAGGGAGTCGTCTTCTTCGTTGTC
TTGGCCCAACCGTGTGGTGGTGACCATGTTTGCTGCCCTATAGTAGTGAAATCTTTTCGTACTAAGGTAGTTTTCCGGTTCAATTGAGATTGCGCCAACA
CTCCAGCCAGCACAACATCTACATCCGCAGGAAGGAGATGCGGAGCTTGCACCAATCCACTCTCCATGAAAAATCGACGAACAATTGACACGTGCACGCC
CACCTCATGGCCGCTCTCCACGGTTATGTCTAGCGACTGAAACAAAGAGTTCAAGCAACTTTGGATCTCCGCTGTTCCGATTGAGTTTGGGTCGTCGTTG
AGAAAGGTTTCCACACAAGTTTGTATAGGATGTACACTTGTGGGTCGATGTAATACTGGTACAGGTGTAGTTGAGTTCAGTGGTTCTGATAGATGACCGG
TTAGTGTTTCACTTGGCAGGGAGTTGCGGCGAGATATCCCCTTCATGGAAGGGTGAATATTAGAGCGATAGGCTCCTTGATGAAGCGCTGCTACCTTTGC
CAGCTCGCTGAAAACCCCTCGTCGGCGAGCATCGGTGTCTTCCTCTCGCATTGACAGAGCTTCCAGACCCTCACGACGGCAGTCTTCAAGTTGTAGTAGC
AATTCTGTCTGCGGAATAACAAGGATAGTTGCTTAGGTGCAGAGGAACCCACATCACGTAAGGGAATTTCGTACCTTTTCATGTTTCAAGATTTCAATCT
GTAACAGCGCATTGTCACGTTCAACTTCCGCCAGTTGTTTCTCATGCTTGCTTTCACGTGTCCGCATCAGGTACTCTGTTCTCATGGCTTCTTTTTGCTG
CAGTTCACGAGTAGAACTCGACTGTTGAGCTGCCAGTGATTTAGCCTCTCGCATCGATTCGTTCAGCGCTAACGAGAGTTGCTCACATTGTGCTGCCTCC
GCAGAACGAAGCGCTCGTTCGACCTGACATCGGCGATCCGCTTCCGCCAACAATGCCTCTAATGACCGCATGCGCCGAAGTATTTGTTGATGCTCATCTG
CGTGACCGGAAAGACGCGCATTCTGAAGAACTAAAAGTTTAGTTTGCTCCTTCGCGCGACGAAGCACTATGCAATATCGATTTTCCAGCTCACGTGAAGC
CATTCGTACACGGTCCACCTCACGAGCACTCGCTTCATATAGCACCTGCCAGTTTTCAGCCTCCTTATATGATGTGTCGAAATGAGGCACCGTTTGAATA
GTGTTTGATTTCGGAAGAGCCTGCCAGTTCATGCCTTCTGTTCTCGGTGCGCCTGAGCCTGATTTTGTTGTAGCAGGCTCTGGGTCTTGCGATATTGCGT
GCAACAGTTCTCTTGTGGGGGTTAAATGAACCTTTGCACAAACTCTAGCACCATTTGGATTTTTACACAGCGCATCTAGATCATCCTCAGAGCCAGCCTC
AGCATCGAATAATTCGGGCTTGGCATTTGCACTACTGGCCTGGGTTACTTGGAGGAAACGATCAAAGTACCCGGTGCCCTCACTGAGGAGAAGTCCGTCT
CCATCCTCGTTCTGTAGATCATTCATATAGGCAGGACTTCCGTCCGAATCGACCGGAAGTTCGTCTCCGCTATCATCATCCGTGTGCGCTGATGTGTGGT
AAGGCATCGTCCGATGCATGTGCGAATACATGAATTCCTCGTAACCATTGTAGTCATCGTTCGTCGATACTGAAATATCATTTTGGGGCTTTGGAGTCGC
TTCGAGGCTCTTTGTATCCAGCAAGCTCTGTAGCCGGGCTGCAACAAATACCATACGGGCTTCATTTTCAATACTTGCAACTTGACTGTGGTGTAGAGCT
TCCACTTGATTTTTTAAAGCTTTCAATATTTACCGAGGGGAAACAGTATCAGTGAAGGATTGAATCGAAAAGAGCAAGCAAACTGAGAACGCATGGGTTT
ACCTTATTTGTGTGACGCCATGAGCTTGTGAAGAATTCGAGAGCATTTGGCGCAGCGTTTCACACGTGATGGGGTCTTGTAGTAGTGTTTCGAGTAGCTC
TACAAAGTCACATGCTACATCATCTGTAGCCGTTGTCGACAATCCATTCTCTGCGATCTCCCAAACATTACGCGAGCACAATGTTTGCTTCACGGGTGGA
TGCATGACCATACTATTGGTTTGGCAAACACATCCGCACAGCATGTATTAGAAAAGTGAAACAATATACCGTCAAAGAAAAGAAAACTGACCTGTTCAGT
ACCGCAACACCATTTGCTTGCACGAGTTCAACGCTCTGCAGCCCACGCATTGCATCTAGGACGGCATTCACCACACTTTGAAAAACGGCAGTAGTAGCAG
TTCGAGACGGAACACTTTGGACCGCAACATCTCGGTACTCAAGCTCCACACAGAGGAAAATAGCACATCCAACGCTGTCACTACGAATTCGGCTTCCTCC
ACAAAAACGGACAAAGCGCTCGTGACCGTCTGAAGCCCTCCATGCCTCAAAATGCGCTCTTTACTGTCCTCTTCAAGCGCCATCTGATGGAGAAATTGGC
ACGCTCGAAGCTGCACAGCAAACACAGTCGCATGTTTCTGCATGACCGAGATACACAGCCGTATCGTATGTGAGACCTGCAAACTCGGTCGGTTCTTACT
ATCCGTCGCTAGTGACTGGAGCGTCTGCAGAGCTGCCGCCGCCTCAAAAGCCGACAGTGTGGAAACTTGCTGATCGGATTCCCCACAGCGAACGATCAAG
TCCGCGACGCCGTCACGGACGAGAGCTTCACGCTCTTGCTCCCCACGACTGCTCACTTTTAATAGGACGCGGTTGACGCACACGAACACCGTCATGAAGC
TGTCGTCGCTGCCGTCGCCTGCCGCGGTTGGCAATGTCCAATAGCTCGCGTCACTCAGCACGGACCGAACACATGCCAGCGTCTTGGTGAATGTTCCGTC
GCCCACACTCAACTCCTGCGGCTTCAAGGACGTCAACAGCACCTCCAGCGCTCGCCACAGCGCCCGCGCTTCAGTCACCCGCTCATTTCTGCGCGGGTCG
TCGTCTTCATTCGCGAGCTCCCACAACCGATCCAGCAGCGCGTCCATCGCGTCGTCGAGAAGATCAGATAGTGCACAAACCCGCACAGGTATTTCTGCCC
TCCTTTATTTTCGGCAACGGCTCACTTCAACTTGTACCAGTCAAGAGCACGCAATGTACCACGTATGCGACATCTCTCAAGACAGCTCTCCCAGTTCCCC
ATTACGCCACCAGTTTAGCTAGCAGTGCGGTGGCCCCTGCCTCATACATAATGGACTCGACAGTGCACGCGACGCCTTCCCTGCCTCCGCCAATGAAGGC
TGCGTCCACGAGCGACATGGACGATCACGAGGCCATGAGTCTGTTCGGGGGTCCTGCAATTACGGCGCCTCCCCCCCGCGCCGGTTAAATCCGTTTCCAC
TGGAGCCATCGCGGACGACCACGGGAGCTACGACCTGTTCGGCTGCAGCGTCCCGATGGCGACCCCAGTGACGAAGGAAGCTGCGCCCATGGCAAGCACC
GCGCCTGTGGAAGATGGGGGCGTCGGGGAGGTGCGCGAGCCTCTTTCGCCAGCAAATTACGAGCTTTTCCCGGCGTTGGCGTCGACCGAGAAGCTGCAAG
ATACTGGGACAACAGAGGGTGATTCGGAGCTATTCCCGTCCTCGAGGGGACTCAGGTGGCAGCAGCAGCAGCAGCAGCAGTGCTACGTCTACGATGAGCG
GTGGAGGATCGTTCCGTGGAGAACCCCCGCGTGCCAACAGTAACGCGCTACAGGTCGTGTCGTCTGGGGACCAACAGAGCTCCCCGCCGACGTACAAGAT
GGCGGGCAACGCAGTGGATATTGTGGCGGTGAAGAACATGGACGGACAGTACCTTACCACGTCGTGGCACGTGTCTTTCTCGTGGTCGCGGTTTCGATCG
AGCTATGTGACGGGTGTGGGAGATATGGTGAGGATCCTGGTCAATGGCAAGGAACTGCCCACGAAGATGGAGCTGCAGGAACGCGGTCGGTGCGTGTTCA
TTACGGGTGGAATTATGATCCCACCGGGCGACCTCCTCTTTGCTGATTTGTCGGACGACCACCCCAACCACGTGCGCTTCGAGCACTTCCAGAAGTACAC
CAACACCGTACGCTATGTAGACGCCAAGCTGCATCTGTGGGGGCCCAACGAATCAGTTGTTGTGGTCGACTTGGACGGTACGCTTACTATTAGTGACGTG
GAAGGCCATATCCGCACACTGCGTCTCGGTCAGTACGATTTCCTGCATGCTGGAGCTTGCGACTTCTTCACCAAGTTGCACGAGCTGGGGATGCGAATCG
TGTACCTCACTGCGCGTCCACTCGACTGGGCATCCGCATCACGTACACACTTGGAGAACGCAGTACAGAATTCGTGCCCACTTCCGCCAGGAGTTCTCAT
CACGAACTCGACTGGTCTCACTGGCGCGCTGTTCACAGAGGTCGTGAACAAGACGCCGCACGTTTTCAAGATCCAGGTGTTGAATGAGCTGCAGCTTACG
CTCATTCACGCTGGCCGTGTGATCGAACAACCCGTCTTCGTCGCTGGCTTCGGCAACCGCCCCACCGACATCGTGGCCTACGAGGAGGTGGGCATGGATC
CCAGCCTCATATTCATGCTAGACCCGTATTCCAACCTCAAGGCTGTAACTGACCCGCGTCTGTACGAGTCCTACAACGACCCGAACGCGCTGCTGTGGAT
GCTGCCCAAGCTCAAGCACCGCGTGCCCATAGAAAAGGTTGGTCGTATCGACGACTACACTGTGCGAGAACTCGTTCTAGCCGAAGACCGTGAGCAGCTT
CGCATGGCCGAGATGCAGGCTCGTCGACTGCAGCAGGAGGAGTTCGAGCGTGCCCGTCAAGAAGCGGACCAAGCTCGATACGCTGCGTCCAACGTTCTCC
GCGCCAGCAGCAGGAGTCTCTCCAGGTAAAAACACAGCAAAATGGCCAACCATCTCGATTGTATGACTACGTACAACAGCAACCAGTAACTTTCATGCAG
ACACCACCAAAATGCAATGGTGCAATCATAACAACACACCATACAAAAGGAAATCAATCGCCACGATGTCATCTGTTCGTCTGTTGTCGCGCGCTCCATG
GGCTCTAAAGGCCCCCGCACAATGCCGGCAAGTCAACTCTCGATCTGCTGCACAGCATCAGCGTCAGTATGAGTTGCTGGTGCCTGGGCTGCAGGCTTTC
CGGCGTCGTAACGGCCACTGCGCCGTCCCGTTGCGCTTTACAATCCCCAGCAGCCACGATGCAGACGCTCCGCAATGGCCTCAAGAAGTGCAGGGAATGA
AGCTCGGCACGCCATCTCCCGGTTTCTAAAAGCCTGTGCGTCGGCCAAGAACCGTCGCGACGTCGGGCTTTGGACCATGTGAAATCGCAACTTTTGGCGG
TCTGGGGCTGGCGAACATCGAGGACTGGAAGCGCTTCCTCTGGGAGGAAGTGACGGTGCCAGCCATGCAGACATACAGCGCCGAGTATGGCGATCTGTTG
GTGCCAGTGTCGTTCACGGTACCGCATGGAGATGGCTCGTGGCCGGTGTCAACGTGGGGATACAAGTTGGGTTACTGGGTAAGCGAGCTACGACGCAGCA
AGGACAAGCTGCTGCAGTATCAACTGGAAGACTTGGAGGCGCTGGAATTCAGCTGGAATGCTCGTGAAGCTCGGTGGAATCGCTTTTTTATTCCTGCCAT
GCAGAGATACCAAGAACTTCATGGCAGTGCACAAGTACCGCAGAGCTTCGTGGTGCCGAGTGACGATCCAGAGTGGGCGGCGGAGTTGAGGGGGTATCGA
TTGGGACAGAAGGTGAACAACTTGCGCTGCGGAGACCCGCTTGGCACAGGGCCCAATGCAGAGGAGTGGCAAGACGTGGAGCTCATTTACAAGAACTGGA
TGCTACTGGAGACGCTGCACGAAGTTGAAGGCAGTGGCGTCCTGGATGAAGAAGTGCTGTCGATCAAGACAAACCAGAAAAATAAAGCAGCAAACCGGCA
CAGCTCTTGATCATCAAGGTTTTCGTGCATTGAATTATAAAATATCGTAACGACACTTGCCCTTAAGTCTTCCGCAACTGGTGCGTAAACACGTCGGCAC
TCAACCATCATGTCATCGCCAAGAAGTCCCACCGCTCAACACTCCTACCATTCGGATCGCTCATTCAAATCGTCCTTGGCTTGACAGGATGTTATCTGCA
GCGATGGGACTTTAGCTTCAGATGCTGGAGCCGAGCTGCACAATGCGCGGGTAGCACGGCAGCGTGAGGAAGTCCACCATGTCGTCGCCAGTCAGCACCT
TACCCATGATCTCGCCACCGAGCGCCCACTTGTTCCCAGGGGTGGCCTTCAGCGAGCGCTTGTTAACACACTCCTTGAGGATGTCCAGCACCAGATCCTT
GGTCACCGTCTTACCCTCCACGGTCTTGCAGCTGTGGCGGATCCACTGCCACACCTGGGCACGCGAGATCTCGGCCGTAGCGGCGTCCTCCATCTTGTTG
TGGAGTGGAATGCAGCCGCTGCCACGCAGCCACGCCTCCGTGTACACGAGGGAGACATCAATGTTCTCTACCAGGCCGTTGTATGTAATGGGGCCAGTCG
GGGGCTCAATGAGCTGAGCAGCAGTGATGTCCTTGCCAGCCTCGGGAATGAACGAGATCTGGTTCGGGCCCGACATCTTGCTGAAAGCATCCATGGCGAT
CTTGACAAGGCCAGGGTGTGCCACCCACGTGCCGTCGTGGCCCGCAGCAACCTCACGTGACTTGTCCTCAGTAACAGCAGCCATGAACTTGTTGTTAAGC
TCCGGGTCGTTCTTGACAGGAATCTGAGCAGCCATGCCGCCCATAGCGTGGGCACCACGACGGTGGCACGTGCGCACGAGCAGCTTCACGTAGGAAGCCA
TGAAGGGCGTGGTCATACCAACTGACGAACGGTCAGGAACCACAAACTTGGCGTGGTTACGGAACTTCTTGATGTACGAGAAGATGTAGTCCCAGCGGCC
GCAGTTGAGCCCGGACGAGTGGTTGCGCAGCTCGTACAGGATCTCGTCCATCTGGAAGACAGCCACGATGGTCTCCACGAGCACCGTCGCACGGACAGAG
CCCTGGGGAATGTTCAGGTAGCCCTGAGCAGCCACGAACACGTCGTTCCACAACTTGGCCTCCAGGTGGTGCTCAAGCTTGGGCAGGTAGTAGTACGGGC
CCGAGCCTCGCGCTAGCAGTTCGTGGGCGTTGTGGAAGAAGTACAGGCCGAAGTCGAAGAGCGAGCCCGACATGATCTGGTTGTTCACGAGCACATGGGC
TTCGTCCAGGTGCCAGCCACGCGGGCGCACCAACAGCGTGGCGATCTTGTCGTTGAGTGCGTACTTCTTCCCGGTTTGCGGGTGGGTATACGAGATGGTC
TTGCGCGCGGCGTCGATGAGGTTCACCTGGCCGTCCACCTGGTTGAACCACGTGGGGGCCGTCGAGTCCTCGAAGTCGGCCATGTAGCACTTCGAGCCCG
AGTTGAGCGCGTTAATCACCATTTTGCGGTCCACGGGGCCCGTGATCTCGACACGACGGTCGGCGAGGTCGGCGGGGATGGGGGCCACCTTCCAGTCGCC
CTCGCGGATGTACCGGGTCTCGGGCAAGAAGTCGGGCAACACGCCAGCGTCGAGCTCCTTCTGGCGCTGCACGCGCGCGGCAACAGCGCCTGGCGCCGCG
GCTCGAACTGCTCATGCAGGAAGGCGAGGAAGCGCAGCGCGTCCGGGGTCAGCACGCGGCGGAAGTCGTCCGAGACGTGGCCCAGCACGCGAACGTTGGC
GGCGTTGACGTTGAGCTCCGACATGGCGGTTGGTTTCTGTTTGAGACTGCTGGAGATGGTCGATGTGTCCCTCGGAGGCAAATTGCGGAATGGCTTCCAG
GAGCGATCCTGAGGCGACGTCTGAGCCGATGCCGACGTGAAGACGCAATGTCTTCAACGTGCAGTTTTGGCCAATGAGGTCGCGTCGTTTCCTGCTAGGT
CCACCATACAAAAGCCAAGTCAAACGACGAGGGACCATCACTCTTCCTTGCGTCTTGTTAAAACTGAAGTTGACGTGTCTTGCATTTCGTGCGATGCAGC
AGCAGGTTTTGCCGGGTGTGATCAAGTTGATTGGACGGGTACTTTCTCTGCATGGGCCGGTGCATGGGAAGTTCCCATTGGAGGCACCTCGTCCTCGATC
GCGAAGTGACGCCGCCGTGTCCTCGGCATTGAATGCTATAATAGTCTTGTGCCTTCAGGAACGAACTCGTGGATGTGCTTGTACCGCCAGACCATTTCGG
TTGTACGGTGCGGATGGTGCGCTGCAACTTCAACGTGTTTGTCCAAGTACATCGCACAACCGCTTGCGTCAAGAACAAACGTTTTTGGTTATCAATTGCG
TTGAAGGGGCCTGGCAGTCCAGCTATCTCAGAAGAATCTCCATCTTCTGTCGATAAAAGCGTTTTACGAGTGCGGTACAACTGAATGCCCGATGCCATTA
CCAAAATGTTTCCTTGGCGAAGGGCCTTGTATTCATCAACTGTTCACCGAGCAAAAAAACATTAAGCTTTATGCGGCAGTGTGCAGAAAGCAACACCAGG
AGATGTTGCTGGACATCCACCAAAGTGGGCGTCCATATGGAAAAAAAATTGGCGACCCCATTTTTTTCAAGTGTTGATACCCACGTTTCGCCTTGCATTT
CATAGGGTTTCAAGTGCAGGCGGCGCCAGATGCCTCTTTAAAACTTCAACGAGTTTCCTAATCGTTGCGTCTAAACTAACTAAATCACGCCGGAGGTGAG
CCCATAATTTCTCTTGGCTGACGGCGTCTTCGGCCTCGTTGAGAGGTGACGCTGTACTGCGGTCGCCTCCGAGAAGCTTTTGGAGAGGTCGATCGCCAGT
CCCAGTGGCACGACATTCTTGGCCTCTTCGATGAGGAAAATCACGGTGCTGAAAGACGGCCGCTGGATCGGGTCGGGGTCCCAGCACGCCTTCATGATTC
GGTGCAGGATCTCTGGGATGTGTGGCAAAAGCTCGGGGCGTAGATCCTCGTGTGCAACGAGGTAAGCGAGGTTGATGGCGTCCTTGTCCAGGTATGGCTT
CTTAAAGCAGAAGAGTTCCCTTGTGGCACGACACATTTCATTAGAATGAAGATCGTATCACAGAGGTGACTGCAGATTCTGTGTACCATAGCACGATGCC
GTAGGAGTAGACGTCGATCTTTTCCGAATAGTCCTCCCCGCGAAATACTTCCGGTGCCAACCACCGAGGAGTGCCGCACATAGTCTGCGCGTTGGTGTTC
TTGTCGAGGCTGCGTGAAAGGCCAAAGTCGCTCAGCTTGCACCGAAAGTCTTCCGTGATCAGTAGATTTTCTCCCTACGAAGACAAACGAGAACCAAAGT
TATAGCCAATATTCAGCCAGCAAATGCAACCGTGTTTTACCTTGATATCGCGGTGAAGCACGGCTGGACTAAGCGCGTGAAGATAGGCACACGCTTTCGC
ACAGTCCATCGCAATTTCGAGTGTGAGACCCCATGTGATGTTGAGCTGCTTGCTCCGAGCGAGCTGTAGCAGGTCGGCCAGAGATCCAGCGCATAGCTCT
GTGAGGAGACAAAGCGTGGGTGGCTCGAGCACTGCACCTAGGAACATCACGATGTTGGGGTGCTGCAGAATGGAGAGAATGGACAGCTCGTTCTTAAAGT
CCTGAACGGTTTTGGCAGAGTATCGCTGGGCAAGTAATCGTTTGAGAGCGACGTGTTTGCCTTTGTAGAACGCCTTGTACACTACACCAAACGTCCCCGT
GCCAATCTGACTCTCGATCTCGATCTCATCGAAAGGAATCTTGAGTCCAAAGAAGACCGAGTTGTCGATGCGTCTCGAGTCTGTGATCGGGTTCACGCGG
TGCTTCTTCTTCGACAATGCAACGTAAACGAGGGTGCCAGCTTGTGTGGTTGACTGGAAGTGGTGCGTCAAGGGTGACACCGTCACAGGTTCGCGCGAGA
ACATGCTACCCATATCATAGGGAGTTGCCCAGAGCTTGCAAGTGATCGTTAGTCGTTGGATCAACGCTGAGCGAGGAAGAACAGCTCGCAGGCCTGACGC
GCGTGAACCAAACAAGGAGAGATGCTTTCTATTTGCAGTAGAGGATATTTTCATCCAGACGGCAAAGAAACTATCGTTCCGATGTCACCGTATTTGGTAG
GTATGAATGAGTATGAGGTGGGCTTCTTGTGCAAGTCAGTCGTGAATTACGAATTGCATTATGAACGAGCTTAAGCTAAAGAAAAGTGTGGAACTACTGC
TTGCAAGGTTGGAACACGCTCGTCTGGATTAGGGAGGAGCACAACATGCTTTTCAGTGGAAAAGGTTTCACACGTCTCTGATAACACCGGGCTCACCAAC
ATTCGAAGTGACCAGCACGCTGGCGCGATTCTCGTCGTCGGGGCTGACCTTCTCCTTGCATGGTGATTTAGTGTCACCACCCGCTAGACTTCCGATTGTT
TGTTTGATGCCGAATGCTGCCAACCCCACGGCAGCGATGGCGCCGACACACGCTACCCCGCCAATAGACCAGTTGACCGCTGTGCTCTTGTGCGGGTCGA
GATCTTCGGAGCTTGGTCCCCTCTCTTCGGCAGAAATGGCACGGGGCACTCCGCCTGAAAGACTGGTGCTGCTTCCTTCATCTGAGGGAGTGCTGTCTGT
ACCGGATAGGTCATAAGCCACGCTGCTGCTGTTCACAATCGCACAGTATTCCAGATACTCAGAGGTGTTTGTAGGGAACCTCATGCAGTACCGGCAGCCT
GCGTCGCCGATGCAGCCTGACGCCAGGCCCTCTGGGCAGTGAGTAGTATCGAGAACGACGCCAATGCCTCCTTCCGCTTGACCATCAGCCAACGACACAT
CTGCACATACATCATCCACTTCCGATGTAAATTCCGTCGACTCGTGCAGTGCTACAATCGTGTCCGCAGAGATGGTCTCGTGTGTGTCCCCGATGAAGGG
GATCGTCTTGAAGTTGATGTCAGCGCCGTTGTCGGAGGAGGGAATATCGGAACAATTCATGTACGAGTGTGACTGGGTTGTCTCGAATCGCTTGCAAAAA
CGGCAGGTGCTATCCACACAACCAACGCCGCCATCACCACATCGGATATCGGTGACGATGTCCAAGCCAAGACTCTTGTCGCCATTAGACGCGGTTTGAT
AGCAATCTAGCGGAATTGAATAGTTGGATGTTGTAGAGACTGGAGCAGTTGTCGGGGCGGCAGAACTCACAACAGGAGTGACAGTGGCAGTAGCGGAGGA
AGTACTCGCAACAGGCGAGTAGTCCGAGCAGCTCCCAAATGCGCCGATTGAACCGTCGATTTCGTCTTGCAAAGACGACAGACACTATCCATACAACCCA
GTCCACCGTTTGTACAGCTCGCATCCGTGATGATGTTGATTCCAACCGCGGCATCGCCATCCGCCACAGTTGACGTACAAACCTTGGTAGGGCTTGTGGT
CGTGGGAGCGGTGGATGGACAGCTATTCAGATGCGCTGCCTGGGTGGTATCCTGTGTCTTGCAATACCGACAAACAGTGTCGATGCATCCAGTGCCGCCA
CTTGAACAACTAGTGTCTGTTACAATGTTAATGCCGACAGCTGCATCGCCAGCACTTACGGTCATGGCACAAGTGCTGGCAGAAGTTGCTTCAATACTTT
CGTACGACGATTCCGTGTTGTCAGCAGACACATCAGAGCTATCGGTGTCGTAGCTTGCATCTGTGCTTTCAGACGAATCCGTTGTGCTTCCAGAGGCGAG
CCTTCGCGTCTGTGTCTCGGGATCGCTGACAACCGGGATTGGTACGAAGTTGATGTCAGAGCCGACATCTGCGGACGGAATACTGGAGCAATTGAGGTAC
GCCTGCGACTGGATCGTATCAAATCGTTTGCAGAAGCGGCACACATCATCCAAACAACCGGTTCCACCCTCGCTGCAGCTGATATCGGAGACGACATCCA
GCCCAACTCCTTTGTCTCCACTTGAAACTGTGCGTGAGCACTCGAAGACGATTGAAGGAGTACTGGAAGTTGCTGTCGTTGTGGGTGTCGGTGATGGCGT
GGCTGTCGTTGTCGGGGTGATTGCTGTCGGAGCCTGAGTACTCGTACCCGTGATTGTAGCACAATCCACGTAAGACGAGGATTGGGTAGTTGTCGTAAGT
CTGCAAAAGCGACACGCAGCATCGATGCAGCCTAAGCCGCCTGCCGCGCATGAAGTGTCCGTGACAATACTTATTCCTGCTGCCACATCACCCGCTGCCG
CCGTAATGCTACAAACTGCAGTAGGAGTCGTTGGAGCCGGCGTTGGAGTCACGGGAACGGTTGGTGCTGGCGTCTTAGTCGGAGCCGCTGTACTTGGTGC
GGGTGTGACTGTCGGAGCTGCCGTGGTAGTTGGTGCTGGCGTTTTAGTCGGAGCCGCTGTGCTTGGTGTGGGTGCGACTGTCGGAGCTGCCGTGGTAGTT
GGTGCAGGTGTGATTGCCGTTCCTTCAATCGAGGCGCAGTCCATGAACGGCGCGGACTGAGCGCTAGTCGTCACTCTGCAAAAGCGGCACACCTGATCAA
GGCACCCCAAGCCTCCGTTGGCGCAACTAAAGTCGGTGACGATCTTGATACCGACTGCTGCATCACCCTCCGACACTGTCTGGGTGCACGGCTGCTTTGT
CGGTGTTGGTGCAGCGGTAGCTGGAACTGCGGTGACAGCTGTGGTCGGGCCGGAGTGGTGGTTATTGGAGCTTGCGTAGTCGAACCGGAGCCCCCAATCA
AGGTACAGTCGACATAAGAAGCAGATTGAGTCGTCACGGTTGCTCGGCAAAATCGGCAGACATTGTCGATGCATCCCAGCCCACCCTGTGCACATGTCGT
GTCCGTAACGATTTTGATGCCAACGGTGGCGTCCCCTTCCGAAGCAACTTGGCTGCACAAGGGCGCGGCTGTAGTCGAGACAATGTTCGAGCAGTTCTGC
AGGTACGCCGATTGGGGGGTTGATCTTGCTCGGCAAAGACGGCAGACGTTGTCCAGACATCCAAGGCCGCCGTCCACACAGGTCGCATCGCTCATGATGT
TAATGCCTACTGCGGCGTTACTCTCAGATACCGTCGTTGTGCAAACCTTAACCGTGGCAGGGCAAGCGTCCAAGTGTGCAGACTGCGTCGTGTTTGTGGC
TCTGCAGAAACGGCAAACGCTGTCAATGCACCCGGTGCCTCCACTGGCGCAGCTCGTGTCCGTCACGACACTGATACCAACCGCTACGTCGCCATCCGTC
GCTGTCAAGTTGCACACAATAGCAGAGCCCGCCTCAAAGGCAACGTCTTCATGCAAGCCAGGTGAACCACTTGTCGAGATGGAAGACTCGGAAGGTTAGC
GTCACTAGTGACTACGATCGGCACGAGACCAACACCCCCTGCATCGCTGTTGGTACTAGACCCTGAGGTACTGCTTTGGCCTTCGACCCACGGGCACGAC
ACAAACTGGGACGACTGGGAAGTTGACTCAGTCTGGCAAAATCTGCAGTGATCATTAAAGCAGCCGATGCCTCCATACAGACAGGAGGGATCTGGCATGG
CGCCTACACCAACTGCAGCATCACCACTCGAAACACCACACGAACCAGTCGAGATCGTTAAAGGCGCCATAGTCGGAAATGAAGTGCCAAGTGACTCACA
ACTCTCAAGGTGCGCCGACTTTAATGTGTCCACCACTTTGCAGTATCGGCAGTCGTTACTGTAGCAGCCAAGGCCACCATCGGCGCACGTGAGATCAGTG
ATCACTTGAATGCCGAACGCTTTATCACCATCTGAAACAGCGCAGATTTCCAACACTTTCTCTCCTACGGACCCGGACGCCGAATTGGACTGCGCGCGAA
TCGTCGGGGTGCTGAAAGCCAAAGCACATATTGCGGCAATCTGTACGACGGAGCGCAACCCCACGCCTGGAGAATACACCATGGCAGCCTCGAATTGAAT
TACTGTTTGACTTTTGTCTTCACACTCGGACTGTGGTCTTCGCACCGCGTTCAAGAATGGTTTGGGTGTGTGTGGGGAGGATGCCAAGGAAAGGGTCATG
GGATCAAGGCTACGAGTGATCGGTTTCGAGCACCAAAGTGCCTGGAATGCCTGCTTCCCATGTTATCAATGCCATGCCCACTCTTCGCTTACGGCCTCAC
GCCAATTGCCGTTGAGGAACTAGCACTGAACATTTTCTTCATGCGAAGCCACAACCGTTGTCACCATTAGTGCACTTAGGTCTTCGTTTCATCATCTATT
TTTTGGGTGGAAGCGAATGGGGTGTTTGCTCGTACGCGATCGAGCAGGAAAATATAGTTGTCACACTCATGAACGTTCCTCCGTTGGAGCAAGCACCATT
GACCAATTCGATTGACTACTATGTTACGTTGCAGGCTGGTGGAAGTACTGTTCGATTAGTTAGGTATCCCCTCGGGACTATAATATGTTTCATGCATGTG
CTCTTTCAGTATCATAGCCGGCATGGCATAGGAGGGTTCCCGTTTTGGTGCTTGGAAGCGCGGAGGGCCAACGTGCAAAAATCACAGAGATGTGATGCAA
TAAAAGTCCGTCGTACAACAAATGTGAAACACGCTGATGACTTCCTGCTGTGGCAACCTACCGTATCACCCGTTGCAATACCGCAGAACAGGGCACGTGA
CGATACCTCTCGGCATTCTTTTGTGTACGCATGCCGCAGAGAAAGAGGACGGGCCTATTAGGCCGCTCGCCGCCGCTGGTGGCGCGCAGTTTGCTTGCAC
TTGTCGCCTCTGAGCAATCGAGTCCAATCGATAGCGCGGTGAATCTGTCTGCCTCCGGGGCCAGACATACACACCAATAGCGCTTGGACTGCTCGCCACA
AGTCAGTCTCAGTTTGAGCACTCTTGCCGGAATGGTCTGGGCAGAAATGCTTTGAAGTGTGGACGGACAGGGCGAATCTCGTTCGCTAGCTTTTGAGCGG
ATAGGCCCATTGAAGTCTGCGGCTCGCACCACGCGAATCTTCGCGTCAAAAATGGCCCGACGACTTTTACAGGCGAGAGGCTGTTGCTCGGCGAGACTTG
CTGGTACAAGCTTGCGTTTGGGCGGCACAAAACTTCATCCGTACGCGAGTGCAGTGCGTGGGAAACTCTTGTCACCCAATTGCAGCTAATAAAGGGAGGA
TTTCCGCTCAAAATCAACTGTGAAGGTGGTATGATACAGTATTGGCCGTGATTTTGAAATGTAGGTGCACATGCTTAGCATTCATAAATGCTAAGCACGC
TAGCAACCTGGAAACCAACACACTCGCCCAACGGAAATGAAAGCGTAAATCGAGCGACCGCCTATCGTTTCATGTACTTACCTAAGGTAATATGAAGGGA
AGTAACCTTCATGGTGGGGCAGGGTGTGGGGAATTGTAAACACGAACGAGAGCGAGGGCACGAACAAGAGAGCCCACGCCTTCTCGACGACAAGTTCTCA
AACAAGCGTGCCATTATTCGCGACTAGGTGCAACTTTGATTCTGTCCTCATCTTCGCACCACTGCCCCGAACGACTTGGGGCGATCAATAGCTGAACATG
CGCTTTCGATCTGGCGGGCACGCGTCCAGCGTTTTGTCGATGGCAAGCTTTTTCGCGTTGGTCGAATCTCGCACCGATTTCCCGTACACTTGTTTTGAGT
ATTCGTCGAATCTCCGAATCTTGATGGGGCTTTTCCCTTGCAGTCAACAATTTACAGCAAAGTTTCAAAAGCGGGTGGATTGGTCATCAAGACGACAGTA
AAAATTTGCACACATACCTGGTTTTGAGGCAGTGCCGAAGGAACTCACCTGATGTTCAGTCCCTGCAAATTGTAATTGCCGCCAACATGAATCTCAACAT
TGAAGCACACGGCGGAAAATCGAGTTGACACCTGCATATGGCTGGGTTTTCGGGCATGAACACGATATTACGGCGTTTCGGAATCTCCGCCGTTCCCTCG
CGCTGGTATCGTTGGCGACACGGCGCTCATCACTTTCCATTCCCGCGCCAGATCGTCAATTCCCGCGACCATGAAGTTCGGCAAAGGCCTGCTGCAGGAA
ATCCTCCAGAGCAACCCGGAGTGGGCGCCCTTCTGGCTCAACTACAAAATCCTCAAGAAGCGCATTAAGGCCGTGACCCGCGCGGCCCACCATGCCGCCA
ACCAGCGCGACATTTGTAAGTGCTTTCGTTTCCGGGGTTCCAGACAATCCGGATAAGTTGCTCATCGAAATGTTTGCGCCCAACAGCCGAATCGGAGCTG
GAAGTAGCCTTCTTTCGCGACCTGCAGGTCGAGCTCAAGAAGATCTCGCTCTTCTACGCCGCGGAGGAGAAACGCTGCTCCTTCCGCTATCACCAGCTGC
GTTCCGTGCTCAAAACCCTCAAGGTTTGTAGCTAACATGTTTTGCGGTTTAAGACACACCAATTCTGACGTGGGTTTCATCAGAAACGAGAGCAGATCGA
GGCGTTCGAAGCTCAGCGTCTCATGTTCGCCTTCGTGCACTTTTACCGAGAGTGCATCCGTCTCGAGAACTTTGCCGTCATTAACTACCAGGGATTTTCC
AAGGTGAGGCCAAAACGTGTTGTACCGTGTCTTTAAGAGGACATCCTATTTAACCGTACTGGTGACGACCTGGCCATGCAGATCTTGAAGAAGCACGACA
AAATGACGGGCTACAACACGCGCTCCAAGTACATGCGCCGCAAGGTAAACCTGTCATCTTTCTCGAGCTACCCGACTCTGCTGCAGATCTTGGCCAGCAC
TGAGGACATGTTCCACGAGGTGGAGCGCGACACCCGCATGTCATCTGCCGTGTCCAGCATCAAGCTCAACATCGAACCACAGGTGGCGACGGACGCTGAC
AGCACCAACGTGTTTGCGCCGGTGGTGCATGTCCCGACTGAGGCGGGAACATCGTCGACCCCAGTGGGGGCTAAGTCTTCGCCGTTGCCTCCCAAGTTCC
TGTCCCCCCATCTCACGCCATCTAATTCATCGGCCCCTGCCCCTTCATTCCCCGCCTCGGTGTTGTGGAATTCGGACGAGCAGGAGGCGGTTTTCCGCGC
GTCGGCGCAGAAGTTCCAGCTCTAGCAAGTGCGATCCACGCAATCATACCAACGTTTAATTTATCCACAGCAACAGGATTGAGTGCACGGCCTGCAACGA
TCACCGAATTGCACGAAGTAAGAACTAAAGTACCGACTGGCGTTTTCATTTTGCAAGATCTTCTTGCACATGAATTAAAGTTTTCGATCTTACAACATCA
TGTTTACAAATAATTTTCGGCTCGACAATTTCACAATTAGCCAACATTTCCCTTTCGAATCCGCATCCGACATAATGGCGCAGTTACTCCGAGCTGCAGG
TCCGCTTGCTTCCTACGCTACAACCCCTTTCACCCAAACTAACCCGACACGATGTATAACAGCTAATGGCAACCTCGAGAAGGTGATCGAGTTGCGCAAC
GACTGGGCCTTCCAGAACAAGAAGGGCGAGTCCGGTATGATACGTCCCGACACCAATCTACTTATTTTGCTTCAGTATGTGCTAAAATGTGTATTTCGTA
ATTGTTTTTATTATATTTTAGTGCTGCACGTGGCGGTGTCCGAGGACCAATTGGAGATCGTGCAGCACCTCGTGTCCAATGGTGCCATGCTCAACCTGCA
GGAGAAGAAGCGCCACTTCACGCCCCTGATGCTGGCGTTGGCCCAGCAGCCGCCCAGGTTTGAGGAGATTTTCCAGGCCTTGCTCAAGGGCAAGCCGGAC
CTGAGTGTGCAGGATGCCTCGGGTCAAACGGTGCTGCATTTGGCGGCAGGTAAAAAGATGTTTTCGTAGAATTATGCTTTTACGTGGAGTTAAATCGTAT
GATGGCTATGCAGAGTATGAGGAAGTGGAGTCATTGAAGTTGCTGCTGAAAGCAAAGGGGAAGGTGGATGCGGTCGACAGCAAGAAAATGACGGCGCTGC
ATGTGGCGGTCGCCAAGGGGAACCTCGAGATCGTCCAGCTGCTGGTGGAGTCTGGCCGCGCTACTGTTAACGTGGTGGACGTCAAAGGCAACACCCCACT
GTAGGTGCACGAGGGAAGCTAGCTATTGCCACCGTGGTGCTAATACTTATGCTGGTGTTGTAGGCACTGGGCATGTATCAAGAATGGCGGTGATCAACTG
GAGCTCATCAGCTACTTGATCTCCAAGGTTCCTACTCTACATAGTAGTGGAATAACAGTTGCTGCCAACCAGGATCTCACCTTTCGTATTGATGTGTGCA
GGGCGCGAAACCCCTTAAGAACGCTCATGGAAGCACACCTCTGCACTCGGAGGCGATGCATTGTGACCCTACTGCAAATTGGCCTACTGCTGCTGCGGAG
GTGCTGACTACTGCGTTTACGGATCTGATAGCCGAGGTCAGCAACAACGGCCTGACTGCCCAGCAAACCTTTGAGCAAGATATCGATGCTGACGAACCTG
TGGAGGACAAGTCACCGGCCAAGTCGTCGAAGAAGGGCGGACGCCGGGGAAAGGGTGACAACGATGAGCAGTTCCTGGAAAACACTGCTGCGGCACGTGC
CGGTACGTGAAAATCGTTGCTGATGTCGAGCTTACTTTTGT