Description :
From Genome Similarity Track
Location :
scaffold_38:103564- 139707
Transcript NameFunction/comments
g12678.t1 hypothetical protein PHYSODRAFT_469584
g12679.t1 malate synthase
g12680.t1 hypothetical protein PHYSODRAFT_475034
g12681.t1 hypothetical protein PHYSODRAFT_248423
g12682.t1 hypothetical protein PHYSODRAFT_353505
g12683.t1 conserved hypothetical protein
g12684.t1 hypothetical protein PHYSODRAFT_408994
g12685.t1hypothetical protein

Sequence
36143 bases(100 bases per row)
GCTGTTGCGACGAGATGTTTAGATGCTGTTTGGGCGTGGCGTGAGTTCAATTTTGTAATTCGAGATACGGATAATGCGGCGGAGAAGACATTCCCGCTGG
CATCGGTATGGCAGCTATTGATTCGAGCTGGTGAAGCAAGCAACAAAACGGATAATGATTTAGAGGTAGTAATGGCTTGCTTCACGAGCTACCTGCAGCA
GTGTGTCACCATGAATATTCGTGACGAAGACCGTCTCCTTTTCAGATTTCTGCTGGCTTTTCGTATATGGCAGCGACGCATGGTGGATGAAAGCTCACCG
TCACCTCGTTTAGCGACATCTGAAAGTAGCGCACAAAGCTGGCGTTCCACTGACATGGAATTATTAGCACGTTTGCTAGCTTTGGTTAGCTGTAAATCTG
TCCACAATTCCCATGATACCTGCCGACCAACGCTGAAAAGTTTACTTGCACTTCGTCCTGCCGGCATGAAATCTATTGCTTGGTCTGCGGTCTGCTATTT
AGCAGAGGCATCTGGGGCTCTCCGACAATTTATCTCGAAAATGGAGAGTGTGGAAGCTGGGCAAATTGTGTGGAAATCGCTGCTCGAGCTGGGAACAAGT
AGTTCAGCTGATTGGGCTGTGCACATTTCCCTTGACGCCTTTACTCGTTTGTGTGTCGTTGTAGCTGTCCATCCGCATCGATTTTTGTGCGAGCTTGAGG
ACTTCGCCGAGCGAGAACTACAACGAATTTACAGTTTTCCCGCGACGTCAACACAATCAAGTACGAATATGAATCTATCGTCACTTTCTTCTGTGGTGGC
CGCAGCATCACACTCATCAATGACTCAAGCCCCCGACTGGCATCGTGATTTATTCTGCATGTGGCAAACATGTTCAAGTGCAAAAGCCCCGCTGGTAGTA
TTTTGCCCACCAAACATTGATTTTATGGATGCGGTAACAAATGTGGCGAGGCGTGCTGGGGCAACGATGGATACGACAGACACTATCCAGCTACTGCTTG
CCGACGAATCCACTTTCAAGAAAATACTGCTACTAGCTATGGAGAAGGGTCAGTGGGTAGTACTTCCAAATGTACACACATGCCTCAACCAAATGGAGCA
AGTGAGCAGTATTTATGAATCATTGGACGATGGGCACGCTCACTCGGATTTCCGTTTATGGATATCAGTGTCAAAACAATCCGTTGAAGATCCTGCAAAG
TGGCAAGCTGATTTTGAAAACAGGAGGATTAATCGAATTGCTACACGACGAGAATGGGGAACTGGGTTTCTTTCATTAAAGCGGAGCCTACACCACACAT
TTGCAATTTTGAAGCATGAGCTCGATGGTTTTGTATGTTCAAGCACCGTTCCAACGCTCCCTACCTTGACGTCAGCAGGTGCTTCGAGATTGAGTGAACA
CGAAGAGAAAATCATGAAGCAACTCGGTGTTTTTCATGCACTTGTCTCGTGTCGTGACCATTTTCAATTTGCACAGTGGAAAGCAGAAGAAGAATTTGGG
GATACAGAATTGTATGCTGCAATTCGCTCTTTAGTGGTTCTACGAACAGATGAAGAGACTGTAATGAAGGAACCGAGTCCTCTGTGTGCGCCCAGCATAG
GAATGTGGAATGAAGTGACACTGCGTGGAGTTATCTCTAATGTCTATGGATCAACACTAGAATCACGGCAAGATCAACTGCTGGCTCAATCCTGTATTGA
TTTTGTGCTTAGCACATGGTCAGAATTGCAAAATGAACACGAACTTGATGCTACAGCAATTATAGGTCGAATGGCCCTACCGGAAGCTGTGCTTGTTATC
GAAAAGCTGGCCACTATCCCATGGATGTCAATCGTAAGCGCCATCTCCCACCTTTGGATAAGTGAATCTTGCGGACCGTCTGCACTGACAAGTGGTGGAT
CACCATTAGACGGTATATCGATATGGGATCCTCAAAACATGCGCAGAAACCGACAGAAGAAAATCACCACGCAATTAGCAGTCCTGGTAGAAAGCAGAGG
ATGTCAGCTGCATACTCGATTACTACCTGGGCGCTCACTTCGCAATATGGAAGTGCTCCCACTGCTCGAGCTTCTCGCTGAATTTGGAAAGAATCTCGAA
GGTGTTGTATTGCCGTCCTCGTTGGGTGATGAGTACGAGTATCGTAAACCGATTTCGGCTCTTGTTAACCATGAAAGACAGGTGCTTGAGCAGATACGAG
CGGTGATTATATGTGATATTAGGAAATTGGAAACGGTATGTTATCCATTCTACTGCTTTCACTGCGATCACTGATATCTAACTTTTTGTTCTGACGCAGG
TCGGCTTTCGGGGTCGTTTTCTTGATTCAGCTACGCAGCAGATATACAATGAACTACGACACAATAGAGTTCCCGCTAGTTGGCTCGCACTACTTCGTCT
AAACACCGGTGGGCCGCAAAAGTGGAGCTTCGACAACTTTCAAAAGCTTTTGCTCGATCGACTTAACACGTTCGCGGCTTGGATGGAACCGGACGATGGT
TCATACATGTACAAGCTGCATCTGGATAAATTCGAGGAGCCTAAGGTGAGTTGTATTTTATGCAATTTGAGGCCAATCATGCTACAGATATTCTGACGAT
ACCTTGTTCAAATATTTTTCTGTGTGTGGAAAGCATGTTTTTGAGGCTGTTCATCAGCATTTCGTCCGTAACCTCGTGGGCAATGCAATGTGCTATCCTG
ACTGTTTGAAGGTTATCTCGTTATTCGAGGATTCTCCGAAACTCACACTGCCGATGAAAGAAGATGTCATATACCTCACTGGTGTTCGAGCTATGGGCCA
TTTACAGCTTCAGGTTATTGATACCAAGGGCCATCTCCGTCGCGCTCCCATAGCTCCTTACGGGGTTCCCGTGATCCTACAAGTAACCAGTTCATGTTTA
TCAGACATGCGTGGAATCTCCGTATCGCCAAAGAGGCCTACTAGCGCGACATTAGAGACGAGTAATGATGGTGACAAGACAAAAGCTGAACCGACCAACC
ATTCAAGTGGGACACGAGAATTCCTGTGCCCATTGTTCACACTTTCAGGTGGGTCTGACTTTGGCAAACGTGCCGAGGCCAGTATCCGTGTGGTTAGCGC
GCTGCCCATTGCACAACTCGTTTTCAGTGGAGCCAGCTTGGAGCTTCAGACTGTCGAGTAGAGCAAACATTAAGATGAATCCTAACACCGGCATGTATGT
AAGTTAAACGTCGAACGCAATCGCGTTTGATACTATTTTGCTTTGCCGGAGTAGAGTTGTCGAGTGAAACGTATAACTAATGGGATATCCGCCTTGCGCA
TGATTTTTTCGCGGCCATTGGAGTTGTCCAACCACTGAAGAAGCCCTGTGATCTGCTGTTCAGGTGTTTCGTAACCAGGTTTCGAACTGAAGAGCTCTAA
TGCAAGCCGGGCCAATATCATTCCAAACCCCACCTTCTTTAGTGTCTCGGCGTCGGCACCACTTGGTGGGTCCTTGTCATGTATTGCAAAATAGACCTTG
AGCAATCCTGCTACCTCAGTATGCAAGCGTTTCAGGCTCACACGATCCATGAATGACGGGATGAGCTCAAAGTCGATCGCGAAGCTGAGCACGAGATCAA
AACTCAACCCGAAGAGTTCGGTTTTGGTCGTCGAGATTGCAGCTGTAGCAGTAGCGTTGGGAAAATGCTGAGAACTATAGAATTCACAAATTGCACCAAG
CGGTCGCTCTTCTCGGCTTAGAACCCCGTTCATTTCCAGCATGGAGATACTACGTCTTCGCGTTTGTGAGAACAGCCGATGGAAGGTGGAGGGTACAAAT
GCCAACGTGTTTCACCGTCCTGGACGCCTGAGCTCTTAGAATTTCGAAGGAGTTCGTTTTCGTTGCCGTGACCCAAGTGGAGAGCCAAGCCAGTGAGAAT
GCTTTTCATCGCTCGACTGAACACCTGCGAAGGCGAACCAACACTGGCCCTTCGCCTGACACCACAGGAAGAAGGTGATCTGCTACGTTGGTTTGTTGAA
GATTGGCATAGAGTTAGCTGCTGTCGAATGTATGGCCGCAAATACAGTGCCACTACTGTCTGGAGTACACGTAGTAAATCCGATCGTGGGAATCTGCGCA
TGCCAATCAATGTTACTGCCTCGTTGAATGCATCCATGTTGAAAAATCTATAGCGCGTGGTATCACCGGCAGGGTTCAGTGATTTTGAGGGAGTCGTCTT
CTTCGTTGTCTTGGCCCAACCGTGTGGTGGTGACCATGTTTGCTGCCCTATAGTAGTGAAATCTTTTCGTACTAAGGTAGTTTTCCGGTTCAATTGAGAT
TGCGCCAACACTCCAGCCAGCACAACATCTACATCCGCAGGAAGGAGATGCGGAGCTTGCACCAATCCACTCTCCATGAAAAATCGACGAACAATTGACA
CGTGCACGCCCACCTCATGGCCGCTCTCCACGGTTATGTCTAGCGACTGAAACAAAGAGTTCAAGCAACTTTGGATCTCCGCTGTTCCGATTGAGTTTGG
GTCGTCGTTGAGAAAGGTTTCCACACAAGTTTGTATAGGATGTACACTTGTGGGTCGATGTAATACTGGTACAGGTGTAGTTGAGTTCAGTGGTTCTGAT
AGATGACCGGTTAGTGTTTCACTTGGCAGGGAGTTGCGGCGAGATATCCCCTTCATGGAAGGGTGAATATTAGAGCGATAGGCTCCTTGATGAAGCGCTG
CTACCTTTGCCAGCTCGCTGAAAACCCCTCGTCGGCGAGCATCGGTGTCTTCCTCTCGCATTGACAGAGCTTCCAGACCCTCACGACGGCAGTCTTCAAG
TTGTAGTAGCAATTCTGTCTGCGGAATAACAAGGATAGTTGCTTAGGTGCAGAGGAACCCACATCACGTAAGGGAATTTCGTACCTTTTCATGTTTCAAG
ATTTCAATCTGTAACAGCGCATTGTCACGTTCAACTTCCGCCAGTTGTTTCTCATGCTTGCTTTCACGTGTCCGCATCAGGTACTCTGTTCTCATGGCTT
CTTTTTGCTGCAGTTCACGAGTAGAACTCGACTGTTGAGCTGCCAGTGATTTAGCCTCTCGCATCGATTCGTTCAGCGCTAACGAGAGTTGCTCACATTG
TGCTGCCTCCGCAGAACGAAGCGCTCGTTCGACCTGACATCGGCGATCCGCTTCCGCCAACAATGCCTCTAATGACCGCATGCGCCGAAGTATTTGTTGA
TGCTCATCTGCGTGACCGGAAAGACGCGCATTCTGAAGAACTAAAAGTTTAGTTTGCTCCTTCGCGCGACGAAGCACTATGCAATATCGATTTTCCAGCT
CACGTGAAGCCATTCGTACACGGTCCACCTCACGAGCACTCGCTTCATATAGCACCTGCCAGTTTTCAGCCTCCTTATATGATGTGTCGAAATGAGGCAC
CGTTTGAATAGTGTTTGATTTCGGAAGAGCCTGCCAGTTCATGCCTTCTGTTCTCGGTGCGCCTGAGCCTGATTTTGTTGTAGCAGGCTCTGGGTCTTGC
GATATTGCGTGCAACAGTTCTCTTGTGGGGGTTAAATGAACCTTTGCACAAACTCTAGCACCATTTGGATTTTTACACAGCGCATCTAGATCATCCTCAG
AGCCAGCCTCAGCATCGAATAATTCGGGCTTGGCATTTGCACTACTGGCCTGGGTTACTTGGAGGAAACGATCAAAGTACCCGGTGCCCTCACTGAGGAG
AAGTCCGTCTCCATCCTCGTTCTGTAGATCATTCATATAGGCAGGACTTCCGTCCGAATCGACCGGAAGTTCGTCTCCGCTATCATCATCCGTGTGCGCT
GATGTGTGGTAAGGCATCGTCCGATGCATGTGCGAATACATGAATTCCTCGTAACCATTGTAGTCATCGTTCGTCGATACTGAAATATCATTTTGGGGCT
TTGGAGTCGCTTCGAGGCTCTTTGTATCCAGCAAGCTCTGTAGCCGGGCTGCAACAAATACCATACGGGCTTCATTTTCAATACTTGCAACTTGACTGTG
GTGTAGAGCTTCCACTTGATTTTTTAAAGCTTTCAATATTTACCGAGGGGAAACAGTATCAGTGAAGGATTGAATCGAAAAGAGCAAGCAAACTGAGAAC
GCATGGGTTTACCTTATTTGTGTGACGCCATGAGCTTGTGAAGAATTCGAGAGCATTTGGCGCAGCGTTTCACACGTGATGGGGTCTTGTAGTAGTGTTT
CGAGTAGCTCTACAAAGTCACATGCTACATCATCTGTAGCCGTTGTCGACAATCCATTCTCTGCGATCTCCCAAACATTACGCGAGCACAATGTTTGCTT
CACGGGTGGATGCATGACCATACTATTGGTTTGGCAAACACATCCGCACAGCATGTATTAGAAAAGTGAAACAATATACCGTCAAAGAAAAGAAAACTGA
CCTGTTCAGTACCGCAACACCATTTGCTTGCACGAGTTCAACGCTCTGCAGCCCACGCATTGCATCTAGGACGGCATTCACCACACTTTGAAAAACGGCA
GTAGTAGCAGTTCGAGACGGAACACTTTGGACCGCAACATCTCGGTACTCAAGCTCCACACAGAGGAAAAATAGCACATCCAACGCTGTCACTACGAATT
CGGCTTCCTCCACAAAAACGGACAAAGCGCTCGTGACCGTCTGAAGCCCTCCATGCCTCAAAATGCGCTCTTTACTGTCCTCTTCAAGCGCCATCTGATG
GAGAAATTGGCACGCTCGAAGCTGCACAGCAAACACAGTCGCATGTTTCTGCATGACCGAGATACACAGCCGTATCGTATGTGAGACCTGCAAACTCGGT
CGGTTCTTACTATCCGTCGCTAGTGACTGGAGCGTCTGCAGAGCTGCCGCCGCCTCAAAAGCCGACAGTGTGGAAACTTGCTGATCGGATTCCCCACAGC
GAACGATCAAGTCCGCGACGCCGTCACGGACGAGAGCTTCACGCTCTTGCTCCCCACGACTGCTCACTTTTAATAGGACGCGGTTGACGCACACGAACAC
CGTCATGAAGCTGTCGTCGCTGCCGTCGCCTGCCGCGGTTGGCAATGCCCAATAGCTCGCGTCACTCAGCACGGACCGAACACATGCCAGCGTCTTGGTG
AATGTTCCGTCGCCCACACTCAACTCCTGCGGCTTCAAGGACGTCAACAGCACCTCCAGCGCTCGCCACAGCGCCCGCGCTTCAGTCACCCGCTCATTTC
TGCGCGGGTCGTCGTCTTCATTCGCGAGCTCCCACAACCGATCCAGCAGCGCGTCCATCGCGTCGTCGAGAAGATCAGATAGTGCACAAACCCGCACAGG
TATTTCTGCCCTCCTTTATTTTCGGCAACGGCTCACTTCAACTTGTACCAGTCAAGAGCACGCAATGTACCACGTATGCGACATCTCTCAAGACAGCTCT
CCCAGTTCCCCATTACGCCACCAGTTTAGCTAGCAGTGCGGTGGCCCCTGCCTCATACATAATGGACTCGACAGTGCACGCGACGCCTTCCCTGCCTCCG
CCAATGAAGGCTGCGTCCACGAGCGACATGGACGATCACGAGGCCATGAGTCTGTTCGGGGGTCCTGCAATTACGGCGCCTCCCCCCGCGCCGGTTAAAT
CCGTTTCCACTGGAGCCATCGCGGACGACCACGGGAGCTACGACCTGTTCGGCTGCAGCGTCCCGATGGCGACCCCAGTGACGAAGGAAGCTGCGCCCAT
GGCAAGCACCGCGCCTGTGGAAGATGGGGGCGTCGGGGAGGTGCGCGAGCCTCTTTCTCCAGCAAATTACGAGCTTTTCCCGGCGTTGGCGTCGACCGAG
AAGCTGCAAGATACTGGGACAACAGAGGGTGATTCGGAGCTATTCCCGTCCTCGAGGGGACTCAGTGGCAGCAGCAGCAGCAGCAGCAGTGCTACGTCTA
CGATGAGCGGTGGAGGATCGTTCCGTGGAGAACCCCCGCGTGCCAACAGTAACGCGCTACAGGTCGTGTCGTCTGGGGACCAACAGAGCTCCCCGCCGAC
GTACAAGATGGCGGGCAACGCAGTGGATATTGTGGCGGTGAAGAACATGGACGGACAGTACCTTACCACGTCGTGGCACGTGTCTTTCTCGTGGTCGCGG
TTTCGATCGAGCTATGTGACGGGTGTGGGAGATATGGTGAGGATCCTGGTCAATGGCAAGGAACTGCCCACGAAGATGGAGCTGCAGGAACGCGGTCGGT
GCGTGTTCATTACGGGTGGAATTATGATCCCACCGGGCGACCTCCTCTTTGCTGATTTGTCGGACGACCACCCCAACCACGTGCGCTTCGAGCACTTCCA
GAAGTACACCAACACCGTACGCTATGTAGACGCCAAGCTGCATCTGTGGGGGCCCAACGAATCAGTTGTTGTGGTCGACTTGGACGGTACGCTTACTATT
AGTGACGTGGAAGGCCATATCCGCACACTGCGTCTCGGTCAGTACGATTTCCTGCATGCTGGAGCTTGCGACTTCTTCACCAAGTTGCACGAGCTGGGGA
TGCGAATCGTGTACCTCACTGCGCGTCCACTCGACTGGGCATCCGCATCACGTACACACTTGGAGAACGCAGTACAGAATTCGTGCCCACTTCCGCCAGG
AGTTCTCATCACGAACTCGACTGGTCTCACTGGCGCGCTGTTCACAGAGGTCGTGAACAAGACGCCGCACGTTTTCAAGATCCAGGTGTTGAATGAGCTG
CAGCTTACGCTCATTCACGCTGGCCGTGTGATCGAACAACCCGTCTTCGTCGCTGGCTTCGGCAACCGCCCCACCGACATCGTGGCCTACGAGGAGGTGG
GCATGGATCCCAGCCTCATATTCATGCTAGACCCGTATTCCAACCTCAAGGCTGTAACTGACCCGCGTCTGTACGAGTCCTACAACGACCCGAACGCGCT
GCTGTGGATGCTGCCCAAGCTCAAGCACCGCGTGCCCATAGAAAAGGTTGGTCGTATCGACGACTACACTGTGCGAGAACTCGTTCTAGCCGAAGACCGT
GAGCAGCTTCGCATGGCCGAGATGCAGGCTCGTCGACTGCAGCAGGAGGAGTTCGAGCGTGCCCGTCAAGAAGCGGACCAAGCTCGATACGCTGCGTCCA
ACGTTCTCCGCGCCAGCAGCAGGAGTCTCTCCAGGTAAAAACACAGCAAAATGGCCAACCATCTCGATTGTATGACTACGTACAACAGCAACCAGTAACT
TTCATGCAGACACCACCAAAATGCAATGGTGCAATCATAACAACACACCATACAAAAGGAAATCAATCGCCACGATGTCATCTGTTCGTCTGTTGTCGCG
CGCTCCATGGGCTCTAAAGGCCCCCGCACAATGCCGGCAAGTCAACTCTCGATCTGCTGCACAGCATCAGCGTCAGTATGAGTTGCTGGTGCCTGGGCTG
CAGGCTTTCCGGCGTCGTAACGGCCACTGCGCCGTCCCGTTGCGCTTTACAATCCCCAGCAGCCACGATGCAGACGCTCCGCAATGGCCTCAAGAAGTGC
AGGGAATGAAGCTCGGCACGGCCATCTCCCGGTTTCTAAAAGCCTGTGCGTCGGCCAAGAAGCCGTCGCGACGTCGGGCTTTGGACCATGTGAAATCGCA
ACTTTTGGCGGTCCTGGGGCTGGCGAACATCGAGGACTGGAAGCGCTTCCTCTGGGAGGAAGTGACGGTGCCAGCCATGCAGACATACAGCACCGAGTAT
GGCGATCTGTTGGTGCCAGTGTCGTTCACGGTACCGCATGGAGATGGCTCGTGGCCGGTGTCAACGTGGGGATACAAGTTGGGTTACTGGGTAAGCGAGC
TACGACGCAGCAAGGACAAGCTGCTGCAGTATCAACTGGAAGACTTGGAGGCGCTGGAATTCAGCTGGAATGCTCGTGAAGCTCGGTGGAATCGCTTTTT
TATTCCTGCCATGCAGAGATACCAAGAACTTCATGGCAGTGCACAAGTACCGCAGAGCTTCGTGGTGCCGAGTGACGATCCAGAGTGGGCGGCGGAGTTG
AGGGGGTATCGATTGGGACAGAAGGTGAACAACTTGCGCTGCGGAGACCCGCTTGGCACAGGGCCCAATGCAGAGGAGTGGCAAGACGTGGAGCTCATTT
ACAAGAACTGGATGCTACTGGAGACGCTGCACGAAGTTGAAGGCAGTGGCGTCCTGGATGAAGAAGTGCTGTCAGATCAAGACAAACCAGAAAAATAAAG
CAGCAAACCGGCACAGCTCTTGATCATCAAGGTTTTCGTGCATTGAATTATAAAATATCGTAACGACACTTGCCCTTAAGTCTTCCGCAACTGGTGCGTA
AACACGTCGGCACTCAACCATCATGTCATCGCCAAGAAGTCCCACCGCTCAACACTCCTACCATTCGGATCGCTCATTCAAATCGTCCTTGGCTTGACAG
GATGTTATCTGCAGCGATGGGACTTTAGCTTCAGATGCTGGAGCCGAGCTGCACAATGCGCGGGTAGCACGGCAGCGTGAGGAAGTCCACCATGTCGTCG
CCAGTCAGCACCTTACCCATGATCTCGCCACCGAGCGCCCACTTGTTCCCAGGGGTGGCCTTCAGCGAGCGCTTGTTAACACACTCCTTGAGGATGTCCA
GCACCAGATCCTTGGTCACCGTCTTACCCTCCACGGTCTTGCAGCTGTGGCGGATCCACTGCCACACCTGGGCACGCGAGATCTCGGCCGTAGCGGCGTC
CTCCATCTTGTTGTGGAGTGGAATGCAGCCGCTGCCACGCAGCCACGCCTCCGTGTACACGAGGGAGACATCAATGTTCTCTACCAGGCCGTTGTATGTA
ATGGGGCCAGTCGGGGGCTCAATGAGCTGAGCAGCAGTGATGTCCTTGCCAGCCTCGGGAATGAACGAGATCTGGTTCGGGCCCGACATCTTGCTGAAAG
CATCCATGGCGATCTTGACAAGGCCAGGGTGTGCCACCCACGTGCCGTCGTGGCCCGCAGCAACCTCACGTGACTTGTCCTCAGTAACAGCAGCCATGAA
CTTGTTGTTAAGCTCCGGGTCGTTCTTGACAGGAATCTGAGCAGCCATGCCGCCCATAGCGTGGGCACCACGACGGTGGCACGTGCGCACGAGCAGCTTC
ACGTAGGAAGCCATGAAGGGCGTGGTCATACCAACTGACGAACGGTCAGGAACCACAAACTTGGCGTGGTTACGGAACTTCTTGATGTACGAGAAGATGT
AGTCCCAGCGGCCGCAGTTGAGCCCGGACGAGTGGTTGCGCAGCTCGTACAGGATCTCGTCCATCTGGAAGACAGCCACGATGGTCTCCACGAGCACCGT
CGCACGGACAGAGCCCTGGGGAATGTTCAGGTAGCCCTGAGCAGCCACGAACACGTCGTTCCACAACTTGGCCTCCAGGTGGTGCTCAAGCTTGGGCAGG
TAGTAGTACGGGCCCGAGCCTCGCGCTAGCAGTTCGTGGGCGTTGTGGAAGAAGTACAGGCCGAAGTCGAAGAGCGAGCCCGACATGATCTGGTTGTTCA
CGAGCACATGGGCTTCGTCCAGGTGCCAGCCACGCGGGCGCACCAACAGCGTGGCGATCTTGTCGTTGAGTGCGTACTTCTTCCCGGTTTGCGGGTGGGT
ATACGAGATGGTCTTGCGCGCGGCGTCGATGAGGTTCACCTGGCCGTCCACCTGGTTGAACCACGTGGGGGCCGTCGAGTCCTCGAAGTCGGCCATGTAG
CACTTCGAGCCCGAGTTGAGCGCGTTAATCACCATTTTGCGGTCCACGGGGCCCGTGATCTCGACACGACGGTCGGCGAGGTCGGCGGGGATGGGGGCCA
CCTTCCAGTCGCCCTCGCGGATGTACCGGGTCTCGGGCAAGAAGTCGGGCAACACGCCAGCGTCGAGCTCCTTCTGGCGCTGCACGCGCGCGGCTAACAG
CGCCTGGCGCCGCGGCTCGAACTGCTCATGCAGGAAGGCGAGGAAGCGCAGCGCGTCCGGGGTCAGCACGCGGCGGAAGTCGTCCGAGACGTGGCCCAGC
ACGCGAACGTTGGCGGCGTTGACGTTGAGCTCCGACATGGCGGTTGGTTTCTGTTTGAGACTGCTGGAGATGGTCGATGTGTCCCTCGGAGGCAAATTGC
GGAATGGCTTCCAGGAGCGATCCTGAGGCGACGTCTGAGCCGATGCCGACGTGAAGACGCAATGTCTTCAACGTGCAGTTTTGGCCAATGAGGTCGCGTC
GTTTCCTGCTAGGTCCACCATACAAAAGCCAAGTCAAACGACGAGGGACCATCACTCTTCCTTGCGTCTTGTTAAAACTGAAGTTGACGTGTCTTGCATT
TCGTGCGATGCAGCAGCAGGTTTTGCCGGGTGTGATCAAGTTGATTGGACGGGTACTTTCTCTGCATGGGCCGGTGCATGGGAAGTTCCCATTGGAGGCA
CCTCGTCCTCGATCGCGAAGTGACGCCGCCGTGTCCTCGGCATTGAATGCTATAATAGTCTTGTGCCTTCAGGAACGAACTCGTGGATGTGCTTGTACCG
CCAGACCATTTCGGTTGTACGGTGCGGATGGTGCGCTGCAACTTCAACGTGTTTGTCCAAGTACATCGCACAACCGCTTGCGTCAAGAACAAACGTTTTT
GGTTATCAATTGCGTTGAAGGGGCCTGGCAGTCCAGCTATCTCAGAAGAATCTCCATCTTCTGTCGATAAAAGCGTTTTACGAGTGCGGTACAACTGAAT
GCCCGATGCCATTACCAAAATGTTTCCTTGGCGAAGGGGCCTTGTATTCATCAACTGTTCACCGAGCAAAAAAACATTAAGCTTTATGCGGCAGTGTGCA
GAAAGCAACACCAGGAGATGTTGCTGGACATCCACCAAAGTGGGCGTCCATATGGAAAAAAAATTGGCGACCCCATTTTTTTCAAGTGTTGATACCCACG
TTTCGCCTTGCATTTCATAGGGTTTCAAGTGCAGGCGGCGCCAGATGCCTCTTTAAAACTTCAACGAGTTTCCTAATCGTTGCGTCTAAACTAACTAAAT
CACGCCGGAGGTGAGCCCATAATTTCTCTTGGCTGACGGCGTCTTCGGCCTCGTTGAGAGGTGACGCTGTACTGCGGTCGCCTCCGAGAAGCTTTTGGAG
AGGTCGATCGCCAGTCCCAGTGGCACGACATTCTTGGCCTCTTCGATGAGGAAAATCACGGTGCTGAAAGACGGCCGCTGGATCGGGTCGGGGTCCCAGC
ACGCCTTCATGATTCGGTGCAGGATCTCTGGGATGTGTGGCAAAAGCTCGGGGCGTAGATCCTCGTGTGCAACGAGGTAAGCGAGGTTGATGGCGTCCTT
GTCCAGGTATGGCTTCTTAAAGCAGAAGAGTTCCCTTGTGGCACGACACATTTCATTAGAATGAAGATCGTATCACAGAGGTGACTGCAGATTCTGTGTA
CCATAGCACGATGCCGTAGGAGTAGACGTCGATCTTTTCCGAATAGTCCTCCCCGCGAAATACTTCCGGTGCCAACCACCGAGGAGTGCCGCACATAGTC
TGCGCGTTGGTGTTCTTGTCGAGGCTGCGTGAAAGGCCAAAGTCGCTCAGCTTGCACCGGAAGTCTTCCGTGATCAGTAGATTTTCTCCCTACGAAGACA
AACGAGAACCAAAGTTATAGCCAATATTCAGCCAGCAAATGCAACCGTGTTTTACCTTGATATCGCGGTGAAGCACGGCTGGACTAAGCGCGTGAAGATA
GGCACACGCTTTCGCACAGTCCATCGCAATTTCGAGTGTGAGACCCCATGTGATGTTGAGCTGCTTGCTCCGAGCGAGCTGTAGCAGGTCGGCCAGAGAT
CCAGCGCATAGCTCTGTGAGGAGACAAAGCGTGGGTGGCTCGAGCACTGCACCTAGGAACATCACGATGTTGGGGTGCTGCAGAATGGAGAGAATGGACA
GCTCGTTCTTAAAGTCCTGAACGGTTTTGGCAGAGTATCGCTGGGCAAGTAATCGTTTGAGAGCGACGTGTTTGCCTTTGTAGAACGCCTTGTACACTAC
ACCAAACGTCCCCGTGCCAATCTGACTCTCGATCTCGATCTCATCGAAAGGAATCTTGAGTCCAAAGAAGACCGAGTTGTCGATGCGTCTCGAGTCTGTG
ATCGGGTTCACGCGGTGCTTCTTCTTCGACAATGCAACGTAAACGAGGGTGCCAGCTTGTGTGGTTGACTGGAAGTGGTGCGTCAAGGGTGACACCGTCA
CAGGTTCGCGCGAGAACATGCTACCCATATCATAGGGAGTTGCCCAGAGCTTGCAAGTGATCGTTAGTCGTTGGATCAACGCTGAGCGAGGAAGAACAGC
TCGCAGGCCTGACGCGCGTGAACCAAACAAAGAGAAATGCTTTCTATTTGCAGTAGAGGATATTTTCATCCAGACGGCAAAGAAACTATCGTTCCGATGT
CACCGTATTTGGTAGGTATGAATGAGTATGAGGTGGGCTTCTTGTGCAAGTCAGTCGTGAATTACGAATTGCATTATGAACGAGCTTAAGCTAAAGAAAA
GTGTGGAACTACTGCTTGCAAGGTTGGAACACGCTCGTCTGGATTAGGGAGGAGCACAACATGCTTTTCAGTGGAAAAGGTTTCACACGTCTCTGATAAC
ACCGGGCTCACCAACATTCGAAGTGACCAGCACGCTGGCGCGATTCTCGTCGTCGGGGCTGACCTTCTCCTTGCATGGTGATTTAGTGTCACCACCCGCT
AGACTTCCGATTGTTTGTTTGATGCCGAATGCTGCCAACCCCACGGCAGCGATGGCGCCGACACACGCTACCCCGCCAATAGACCAGTTGACCGCTGTGC
TCTTGTGCGGGTCGAGATCTTCGGAGCTTGGTCCCCTCTCTTCGGCAGAAATGGCACGGGGCACTCCGCCTGAAAGACTGGTGCTGCTTCCTTCATCTGA
GGGAGTGCTGTCTGTACCGGATAGGTCATAAGCCACGCTGCTGCTGTTCACAATCGCACAGTATTCCAGATACTCAGAGGTGTTTGTAGGGAACCTCATG
CAGTACCGGCAGCCTGCGTCGCCGATGCAGCCTGACGCCAGGCCCTCTGGGCAGTGAGTAGTATCGAGAACGACGCCAATGCCTCCTTCCGCTTGACCAT
CAGCCAACGACACATCTGCACATACATCATCCACTTCCGATGTAAATTCCGTCGACTCGTGCAGTGCTACAATCGTGTCCGCAGAGATGGTCTCGTGTGT
GTCCCCGATGAAGGGGATCGTCTTGAAGTTGATGTCAGCGCCGTTGTCGGAGGAGGGAATATCGGAACAATTCATGTACGAGTGTGACTGGGTTGTCTCG
AATCGCTTGCAAAAACGGCAGGTGCTATCCACACAACCAACGCCGCCATCACCACATCGGATATCGGTGACGATGTCCAAGCCAAGACTCTTGTCGCCAT
TAGACGCGGTTTGATAGCAATCTAGCGGAATTGAATAGTTGGATGTTGTAGAGACTGGAGCAGTTGTCGGGGCGGCAGAACTCACAACAGGAGTGACAGT
GGCAGTAGCGGAGGAAGTACTCGCAACAGGCGAGTAGTCCGAGCAGCTCCCCAAATGCGCCGATTGAACCGTCGATTTCGTCTTGCAAAGACGACAGACA
CTATCCATACAACCCAGTCCACCGTTTGTACAGCTCGCATCCGTGATGATGTTGATTCCAACCGCGGCATCGCCATCCGCCACAGTTGACGTACAAACCT
TGGTAGGGCTTGTGGTCGTGGGAGCGGTGGATGGACAGCTATTCAGATGCGCTGCCTGGGTGGTGTCCTGTGTCTTGCAATACCGACAAACAGTGTCGAT
GCATCCAGTGCCGCCACTTGAACAACTAGTGTCTGTTACAATGTTAATGCCGACAGCTGCATCGCCAGCGCTTACGGTCATGGCACAAGTGCTGGCAGAA
GTTGCTTCAATACTTTCGTACGACGATTCCGTGTTGTCAGCAGACGCATCAGAGCTATCGGTGTCGTAGCTTGCATCTGTGCTTTCAGACGAATCCGTTG
TGCTTCCAGAGGCGAGCCTTCGCGTCTGTGTCTCGGGATCGCTGACAACCGGGATTGGTACGAAGTTGATGTCAGAGCCGACATCTGCGGACGGAATACT
GGAGCAATTGAGGTACGCCTGCGACTGGATCGTATCAAATCGTTTGCAGAAGCGGCACACATCATCCAAACAACCGGTTCCACCCTCGCTGCAGCTGATA
TCGGAGACGACATCCAGCCCAACTCCTTTGTCTCCACTTGAAACTGTGCGTGAGCACTCGAAGACGATTGAAGGAGTACTGGAAGTTGCTGTCGTTGTGG
GTGTCGGTGATGGCGTGGCTGTCGTTGTCGGGGTGATTGCTGTCGGAGCCTGAGTACTCGTACCCGTGATTGTAGCACAATCCACGTAAGACGAGGATTG
GGTAGTTGTCGTAAGTCTGCAAAAGCGACACGCAGCATCGATGCAGCCTAAGCCGCCTGCCGCGCATGAAGTGTCCGTGACAATACTTATTCCTGCTGCC
ACATCACCCGCTGCCGCCGTAATGCTACAAACTGCAGTAGGAGTCGTTGGAGCCGGCGTTGGAGTCACGGGAACGGTTGGTGCTGGCGTCTTAGTCGGAG
CCGCTGTACTTGGTGCGGGTGTGACTGTCGGAGCTGCCGTGGTAGTTGGTGCTGGCGTTTTAGTCGGAGCCGCTGTGCTTGGTGTGGGTGCGACTGTCGG
AGCTGCCGTGGTAGTTGGTGCAGGTGTGATTGCCGTTCCTTCAATCGAGGCGCAGTCCATGAACGGCGCGGACTGAGCGCTAGTCGTCACTCTGCAAAAG
CGGCACACCTGATCAAGGCACCCCAAGCCTCCGTTGGCGCAACTAAAGTCGGTGACGATCTTGATACCGACTGCTGCATCACCCTCCGACACTGTCTGGG
TGCACGGCTGCTTTGTCGGTGTTGGTGCAGCGGTAGCTGGAACTGCGGTGACAGCTGTGGTCGGGGCCGGAGTGGTGGTTATTGGAGCTTGCGTAGTCGA
ACCGGAGCCCCCAATCAAGGTACAGTCGACATAAGAAGCAGATTGAGTCGTCACGGTTGCTCGGCAAAATCGGCAGACATTGTCGATGCATCCCAGCCCA
CCCTGTGCACATGTCGTGTCCGTAACGATTTTGATGCCAACGGTGGCGTCCCCTTCCGAAGCAACTTGGCTGCACAAGGGCGCGGCTGTAGTCGAGACAA
TGTTCGAGCAGTTCTGCAGGTACGCCGATTGGGGGGTTGATCTTGCTCGGCAAAGACGGCAGACGTTGTCCAGACATCCAAGGCCGCCGTCCACACAGGT
CGCATCGCTCATGATGTTAATGCCTACTGCGGCGTTACTCTCAGATACCGTCGTTGTGCAAACCTTAACCGTGGCAGGGCAAGCGTCCAAGTGTGCAGAC
TGCGTCGTGTTTGTGGCTCTGCAGAAACGGCAAACGCTGTCAATGCACCCGGTGCCTCCACTGGCGCAGCTCGTGTCCGTCACGACACTGATACCAACCG
CTACGTCGCCATCCGTCGCTGTCAAGTTGCACACAATAGCAGAGCCCGCCTCAAAGGCAACGTCTTCATGCAAGCCAGGTGAACCACTTGTCGAGATGGA
AGACTCGGAAGGTTTAGCGTCACTAGTGACTACGATCGGCACGAGACCAACACCCCCTGCATCGCTGTTGGTACTAGACCCTGAGGTACTGCTTTGGCCT
TCGACCCACGGGCACGACACAAACTGGGACGACTGGGAAGTTGACTCAGTCTGGCAAAATCTGCAGTGATCATTAAAGCAGCCGATGCCTCCATACAGAC
AGGAGGGATCTGGCATGGCGCCTACACCAACTGCAGCATCACCACTCGAAACACCACACGAACCAGTCGAGATCGTTAAAGGCGCCATAGTCGGAAATGA
AGTGCCAAGTGACTCACAACTCTCAAGGTGCGCCGACTTTAATGTGTCCACCACTTTGCAGTATCGGCAGTCGTTACTGTAGCAGCCAAGGCCACCATCG
GCGCACGTGAGATCAGTGATCACTTGAATGCCGAACGCTTTATCACCATCTGAAACAGCGCAGATTTCCAACACTTTCTCTCCTACGGACCCGGACGCCG
AATTGGACTGCGCGCGAATCGTCGGGGTGCTGAAAGCCAAAGCACATATTGCGGCAATCTGTATGACGGAGCGCAACCCCACGCCTGGAGAATACACCAT
GGCAGCCTCGAATTGAATTACTGTTTGACTTTTGTGTCTTCACACTCGGACTGTGGTCTTCGCACCGCGTTCAAGAATGGTTTGGGTGTGTGTGGGGAGG
ATGCCAAGGAAAGGGTCATGGGATCAAGGCTACGAGTGATCGGTTTCGAGCACCAAAGTGCCTGGAATGCCTGCTTCCCATGTTATCAATGCCCATGCCC
ACTCTTCGCTTACGGCCTCACGCCAATTGCCGTTGAGGAACTAGCACTGAACATTTTCTTCATGCGAAGCCACAACCGTTGTCACCATTAGTGCACTTAG
GTCTTCGTTTCATCATCTATTTTTTGGGTGGAAGCGAATGGGGTGTTTGCTCGTACGCGATCGAGCAGGAAAATATAGTTGTCACACTCATGAACGTTCC
TCCGTTGGAGCAAGCACCATTGACCAATTCGATTGACTACTATGTTACGTTGCAGGCTGGTGGAAGTACTGTTCGATTAGTTAGGTATCCCCTCGGGACT
ATAATATGTTTCATGCATGTGCTCTTTCAGTATCATAGCCGGCATGGCATAGGAGGGTTCCCGTTTTGGTGCTTGGAAGCGCGGAGGGCCAACGTGCAAA
AATCACAGAGATGTGATGCAATAAAAGTCCGTCGTACAACAAATGTGAAACACGCTGATGACTTCCTGCTGTGGCAACCTACCGTATCACCCGTTGCAAT
ACCGCAGAACAGGGCACGTGACGATACCTCTCGGCATTCTTTTGTGTACGCATGCCGCAGAGAAAGAGGACGGGCCTATTAGGCCGCTCGCCGCCGCTGG
TGGCGCGCAGTTTGCTTGCACTTGTCGCCTCTGAGCAATCGAGTCCAATCGATAGCGCGGTGAATCTGTCTGCCTCCGGGGCCAGACATACACACCAATA
GCTCTTGGACTGCTCGCCACAAGTCAGTCTCAGTTTGAGCACTCTTGCCGGAATGGTCTGGGCAGAAATGCTTTGAAGTGTGGACGGACAGGGCGAATCT
CGTTCGCTAGCTTTTGAGCGGATAGGCCCATTGAAGTCTGCGGCTCGCACCACGCGAATCTTCGCGTCAAAAATGGCCCGACGACTTTTACAGGCGAGAG
GCTGTTGCTCGGCGAGACTTGCTGGTACAAGCTTGCGTTTGGGCGGCACAAAACTTCATCCGTACGCGAGTGCAGTGCGTGGGAAACTCTTGTCACCCAA
TTGCAGCTAATAAAGGGAGGATTTCCGCTCAAAATCAACTGTGAAGGTGGTATGATACAGTATTGGCCGTGATTTTGAAATGTAGGTGCACATGCTTAGC
ATTCACAAATGCTAAGCACGCTAGCAACCTGGAAACCAACACACTCGCCCAACGGAAATGAAAGCGTAAATCGAGCGACCGCCTATCGTTTCATGTACTT
ACCTAAGGTAATAGGAAGGGAAGTAACCTTCATGGTGGGGCAGGGTGTGGGGAATTGTAAACACGAACGAGAGCGAGGGCACGAACAAGAGAGCCCACGC
CTTCTCGACGACAAGTTCTCAAACAAGCGTGCCATTATTCGCGACTAGGTGCAACTTTGATTCTGTCCTCAACTTCGCACCACTGCCCCGAACGACTTGG
GGCGATCAATAGCTGAACATGCGCTTTCGATCTGGCGGGCACGCGTCCAGCGTTTTGTCGATGGCAAGCTTTTTCGCGTTGGTCGAATCTCGCACCGATT
TCCCGTACACTTGTTTTGAGTATTCGTCGAATCTCCGAATCTTGATGGGGCTTTTCCCTTGCAGTCAATAATTTACAGCAAAGTCTCAAAAGCGGGTGAG
ATTGGTCATCAAGACGACAGTAAAAATTTGCACACATACCTGGTTTTGAGACAGTGCCGAAGGAACTCACCTGATGTTCAGTTCCTGCAAATTGTAATTG
CCGCCAACATGAATCTCAACATTGAAGCACACGGCGGAAAATCGAGTTGACACCTGCATATGGCTGGGTTTTCGGGCATGAACACGATATTACGGCGTTT
CGGAATCTCCGCCGTTCCCTCGCGCTGGTATCGTTGGCGACACGGCGCTCATCACTTCCCATTCCCGCGCCAGATCGTCAATTCCCGCGACCATGAAGTT
CGGCAAAGGCCTGCTGCAGGAAATCCTCCAGAGCAACCCGGAGTGGGCGCCCTTCTGGCTCAACTACAAAATCCTCAAGAAGCGCATCAAGGCCGTGACC
CGCGCGGCCCACCATGCCGCCAACCAGCGCGACATTTGTAAGTGCTTTCGTTTCCGGGGTTCCAGACAATCCGGATAAGTTGCTCATCGAAATGTTTGCG
CCCAACAGCCGAATCGGAGCTGGAAGTAGCCTTCTTTCGCGACCTGCAGGTCGAGCTCAAGAAGATCTCGCTCTTCTACGCCGCGGAGGAGAAACGCTGC
TCCTTCCGCTATCACCAGCTGCGTTCCGTGCTCAAAACCCTCAAGGTTTGTAGCTAACATGTTTTGCGGTTTAAGACACACCAATTCTGACGTGGGTTTC
ATCAGAAACGAGAGCAGATCGAGGCGTTCGAAGCTCAGCGTCTCATGTTCGCCTTCGTGCACTTTTACCGAGAGTGCATCCGTCTCGAGAACTTTGCCGT
CATTAACTACCAGGGATTTTCCAAGGTGAGGCCAAAACGTGTTGTACCGTGTCTTTAAGAGGACATCCTATTTAACCGTACTGGTGACGACCTGGCCATG
CAGATCTTGAAGAAGCACGACAAAATGACGGGCTACAACACGCGCTCCAAGTACATGCGCCGCAAGGTAAACCTGTCATCTTTCTCGAGCTACCCGACTC
TGCTGCAGATCTTGGCCAGCACTGAGGACATGTTCCACGAGGTGGAGCGCGACACCCGCATGTCATCTGCCGTGTCCAGCATCAAGCTCAACATCGAACC
ACAGGTGGCGACGGACGCTGACAGCACCAACGTGTTTGCGCCGGTGGTGCATGTCCCGACTGAGGCGGGAACATCGTCGACCCCAGTGGGGGCTAAGTCT
TCGCCGTTGCCTCCCAAGTTCCTGTCCCCCCATCTCACGCCATCTAATTCATCGGCCCCTGCCCCTTCATTCCCCGCCTCGGTGTTGTGGAATTCGGACG
AGCAGGAGGCGGTTTTCCGCGCGTCGGCGCAGAAGTTCCAGCTCTAGCAAGTGCGATCCACGCAATCATATCAACGTTTAATTTATCCACAGCAGCAGGA
TTGAGTGCACGGCCTGCAACGATCACCGAATTGCACGAAGTAAGAACTAAAGTACCGACTGGCGTTTTCATTTTGCAAGATCTTCTTGCACATGAATTAA
AGTTTTCGATTTTACAACATCATGTTTACAAATAATTTTCGGCTCGACAATTTCACAATTAGCCAACATTTCCCTTTCGAATCCGCATCCGACATAATGG
CGCAGTTACTCCGAGCTGCAGGTCCGCTTGCTTCCTACGCTACAACCCCTTTCACCCAAACTAACCCGACACGATGTATAACAGCTAATGGCAACCTCGA
GAAGGTGATCGAGTTGCGCAACGACTGGGCCTTCCAGAACAAGAAGGGCGAGTCCGGTATGATACGTCCCGACACCAATCTACTTATTTTGCTTCAGTAT
GTGCTAAAATGTGTATTTCGTAATTGTTTTTATTATATTTTAGTGCTGCACGTGGCGGTGTCCGAGGACCAATTGGAGATCGTGCAGCACCTCGTGTCCA
ATGGTGCCATGCTCAACCTGCAGGAGAAGAAGCGCCACTTCACGCCCCTGATGCTGGCGTTGGCCCAGCAGCCGCCCAGGTTTGAGGAGATTTTCCAGGC
CTTGCTCAAGGGCAAGCCGGACCTGAGTGTGCAGGATGCCTCGGGTCAAACGGTGCTGCATTTGGCGGCAGGTAAAAAGATGTTTTCGTAGAATTATGAT
TTTACGTGGAGTTAAATCGTATGATGGCTATGCAGAGTATGAGGAAGTGGAGTCATTGAAGTTGCTGCTGAAAGCAAAGGGGAAGGTGGATGCGGTCGAC
AGCAAGAAAATGACGGCGCTGCATGTGGCGGTCGCCAAGGGGAACCTCGAGATCGTCCAGCTGCTGGTGGAGTCTGGCCGCGCTACTGTTAACGTGGTGG
ACGTCAAAGGCAACACCCCACTGTAGGTGCACGAGGGAAGCTAGCTATTGCCACCGTGGTGCTAATACTTATGCTGGTGTTGTAGGCACTGGGCATGTAT
CAAGAATGGCGGTGATCAACTGGAGCTCATCAGCTACTTGATCTCCAAGGTTCCTACTCTACATAGTAGTGGAATAACAGTTGCTGCCAACCAGGATCTC
ACCTTTCGTATTGATGTGTGCAGGGCGCGAAACCCCTTAAGAACGCTCATGGAAGCACACCTCTGCACTCGGAGGCGATGCATTGTGACCCTACTGCAAA
TTGGCCTACTGCTGCTGCGGAGGTGCTGACTACTGCGTTTACGGATCTGATAGCCGAGGTCAGCAACAACGGCCTGACTGCCCAGCAAACCTTTGAGCAA
GATATCGATGCTGACGAACCTGTGGAGGACAAGTCACCGGCCAAGTCGTCGAAGAAGGGCGGACGCCGGGGAAAGGGTGACAACGATGAGCAGTTCCTGG
AAAACACTGCTGCGGCACGTGCCGGTACGTGAAAATCGTTGCTGATGTCGAGCTTACTTTTGTCCGAGGTGTGTTTATTAACTCTCCATATTGCAGCCGC
TATTGCACACTCGAAGAAGAAGGTGTCCAAAACCGGCAAGGATGGCAACAGTGGCATGGCTCCTTACATGTGGGTCGCCTTACTTTTTGCCATCTTAGCT
GTCCTGAATGCCTTGCTTTCATCGTAGTGGCTAGGATTGCAACCAGAAATTCCTTGTTGAACGGAAGCTAATGAAGTTGCATTTGATCACTTCAATACTT
CGAAGTACTTTTGCGTCGATTTTCAAAGATTAGTGTGGTATGTTACGGCTCGATGGTGTGGGAGACAGCTATATGAAATTGTGTCAGCCTACCTGTATTT
GTTGACTTATCTTTTCAATCACTGTCCGACGAAGAATCGTCGTCGTGGCGATCTTCTTCCCCCTCCTCCTCCTCGTCTTCTTCCCCAACATCAGCCTCAT
CTTCGATAAACCGGTTGCGGCCACGGGATCGCCCAGCGATTTCAACTTCTTCCTCTGAGTCCGACTCGCCCTCGAAAGGGTCCTCATCAACCTCGCTGTC
ATCCTCATCGATTTCTTCTTCAGATCCCTCCTCGCCACTGAACTCGCTGTCTTCGTTGGCGAGAAACCCCTTTAGGTTGCCATTCTCGTCGACATCTTCC
TGGTCCAAACGACTCGGGAAGTCCAATCGACCAATAAGATCCGGCAGGTCGACCAAGATCTCATCCTGGTTGCCGTCCAAGTCGTCGAAGACGTTTGAGA
GCAGCACCTGCTGAACCAAGGCAATCTTACGCTCAAGCTGCCAATGCTCACACAGCTGCTTCAGCAGACAACCAACGTCACGAACTGTGGACAAACTTTC
AAGCAATGGGTGCATCAGTTCCATCACTTCACCATTCGATTCCATAAGTGCAAAACGACGCTCTAGTGCCGACACAAAGGACGGGTCACGGACGCTCAAA
TGACCATTCTCCACAGCCGACGCCATTTTGTTCATAACCACTCCAGAGTTACCTGATCCAGCCTCAAAAATTTGCACAAGCTGTTCTGCAGACAAGTTAA
TGCCCAATCCTTCGAGGAAATCAACGTTTACCAGCTCAGGGCACGTCTCGCAAAGGAAGCGGGCTGTTTTACTCTCCTTGAAACTCCACTCTGCAGCAAA
CAATCGGACCAGTCGGCCAACCTCCACGAGCTCCCACCGCTCTCGGGCGGCCGAATCAATGAGACGAGTATACAATGATGCGTTGTGGCCATCGTTGTGG
TCGATGTCAAAGTCACCACCTTCATCGCTATCTGAAGAAGATTCATCCGAGAGTTGAATAACTGGAGCCGCCACAGCTTTTTTAGCTGGGTAGGGAGTCA
CCATAGCTTTATGCACTTGTTTGACGGCAACTTGAGGTTGCCGTGGTGCTTCGTGGGCAGGTAAGAACATGTCATCTTTCTTCTTCGCGTCCTCTGCAAG
AGAAGCCGCAATCGGTGTCAATTGTTTTGTCGAAGCTAGGGGCTCCTCCTCAACTGCAGCAGTGCCAATTATTTTGCTGGTTTTCGCCTTCTTGGAGGCA
ACTACAGGGGCACGACCAGATGCATTTGTCGTGCTGGCGGATTGACGTTCTGGATCATCCGACACAATCAAGGTTTTTCCTCGTCTTGGCTGCGCTGGAG
CGAGCGTCTTGGGTGATACGCTGTTCAAACTCGTTGCTTCGGGTGACTTTTTCCGTTTTTTGCGAGACTTCGGTGAAGGTGCAGGCGTATCCGATGGTGA
GGTATTTTTCTTTATCAAGTCGGCGCCCGCACTCTTTGCAGTAACCGCGGGTAAATCATTTTGGACTCCCTTCGAGTTTGATGCCGAGGATCCAGACGTA
TGGTTGCTGCCACAGGTAGCCTTCTCTCGAAGTTCTTTGCGTTTTTTCTTCAATTTCTTAATCTTCGTCTTGGATGGATGTGCATGAGGGTCGCTGCCAT
TGTTGCTGTCGGTAGCAGGTTGCAGAGCATCATTCTTCTTCTCAAAAGCTCCAACACTCTCCTTTGCCTTCTCCATCTTCGAAACAGCAACGGCCTTGCG
CGCCGCACTCTTCTGCTTCTTATGAGGCGGTTTGACTATCTGCTGCGTAGCAATCTCCTTCATCTTTCTCAAAGCCTGCTCCAACGGATCCACTCCATTG
TCTTCCTCATGATCTTCATCCTTCTTCATCGCATGCCACGGCGCCTGCACCGGCACCTTGGTCATTTTCACCGCCTCCACCGAATCCTGCTGCTTCTTCT
TTTTCGTCTTCACCTTCTTCTTCTTCACGTCTTGGACAACAAGAGCAACAGTTTTCTCCTGCTTCTTAACGATGGCGTTCGACATACCCGGCACGGTCAC
GACTCTCGCCCCAGCCGCCCCCTTCTTCTCCACCACTTTCTTCTTCTCCTTGGGCTTCTTCTCCTTCTTCACTTTGTTCTTAACGAATTTCACCATTGGC
ACGGGCTCTCCGTCGTCCGCAAAATTCTTCTTTTGCTTCTTGTGCTTGGACTTGAACAGCACGCGGGGCGTCTCTGGGGCCACTGCAGTTGCTTCTTCCT
GCGGTAGCTCGAACATGCGCGCGTGGAAGGATGCCAGCCGCTCGCGTGCATCATCATCACCGCCTTGGAAGCTCTCGGAGCGCTGGCGCTTGCGCTTCAT
CTTGGCCAGTGGAGCAATTGGCTGCGACCGTTTCGATCGTCCGAACCAGCAGCTTTTAAGCCAATGATAACGCAATATTTATATTTCCTACCCAATCAGA
TGGCTAGTCCGAAAAAGGCAACTATTAACTTGGAAAATGAGACCGTCGACGCTGGCGGTGGGGCTGGTGATTTTGGCCACGTGCTGTGCTTTAGGCGTGT
ACGGGAAGCACTCGCGATACACTGAGAAATGTGGCAGGAAGACCAAGCAAGATCGTCGAGAAATGTTGCGCTCCAACCGCCGCAGTCGCAAGGACAAACT
ACTCAAAGCCAAGAAGCTCGCGCGAAGTGAAGCGGTGGTTGCTGAACGGGCTGGGATGACGGAGGAACAAAAGTGCGAGCAGCGAGAACGGATCCGCATG
CAACGTGTGGAGCAATACGTGAGTTTTTTTGCAGTGAAATAGTATGTTTGAGTTGATTTGGGCACTGAACTTCGTTGTGTTTGTGCAGCAAAAGCTGGAG
GAGGCTCAGTTGAGTGGCATTCGCGTGGTGGTTGACTTGGTGTTTGCCGAAGACCAGACAACTCGAGTGAGTTTCACATTTGAGATCTGGTGATAAAGTT
GTTGTTGTTGCTGACGAGCTGTAATGCGTTAAAGGAGCGTAACAGCATTTTCAAGCAGCTCGGGTGTGTGTACGGGTATCTGAAAACTTGTCCGCTAGAC
AGACTTCTGTCGCTGCATCTCGCCTCCTGTACGCAAAAACTTGCTGCCGTTTGCGCTCAGCACGGTGTGCTACGTTGGAAGGTATGGATTATTGTGACCT
TGTGCTGCAAACTTGTGGGCCTGACCATGCTTTGATGCAGGTCGGAAGGCACGAAGAGCCTCTCGAGCAGCTGTATGACGTCGGCGAACTCGTATACCTT
TCACCGGACTCGGATAACGTGCTTGAAACGCTGGATCCAGGCTGCGTGTATGTCATCGGTGGCATCGTCGATCGATCAGTTCGCAAGGTACTTAGCGTAG
CCACTGAATTCTGATGATAACCTACGAATTTGCCAGCTCATCCGTGAAATTGATGGGTTTTCTACAGGGCGAGACGAAGGCAAAAGCGGCTGCGCATGGC
ATTCAAACTGCACGATTGCCACTTCAAGAGCACTTTGAACAGACCGGAGCACGAGTTCGAACTCACATCATGAACCTAGATTCTGTGATCATTACGCTGA
ACGAAGTGGCAAATCATGGCGATTGGGGGCGTGCCTTTCGGAAAGCGGTGCCGCTACGGATCTCTCGCTCAAAACAAGCTAAGAAGAATCGCGTGGAGAA
CGATGCTTAACTCGGGCGCTGGTGAGCGTGTGCAAATGGTGGGAACCTTAGTTAACGTGTTGATTGAAAAATAAAATATGAATATGCATCCTCATATCGA
TACAACGAGGGGTGATCTGCTCACTCTCCAACCATGGTGGCCATGCCAGCAATCACGCTTGAGACTGCAGCAGTTGCCGTAGCTGTAGCAGTGGCGGCAG
CATTGGTCCAGTTAATGCCTTGGCCAGCTCGTTGAGCTACCGTCGTATTGTCTGCATCGATAGACTGGCAGTGAGTGATGGCGTACACGAGTTTATCGTG
CATGACTTCACGACACGAGTACGACGGCAGATCGATGGAAAAGAAACCTGCAATACAACGCCACAGCGTTAGTATGGCGCATTCACGTACAACGTTATTG
GGAAGCATAGCTTACAGGTATGAGCGATGGGCAAGTACATATCAGCACGACCCGCAGCCTTCGGGAGACCCGAAATCTTGAAGTCCTGCGTGAAGTCTGC
TGCATGTGTAGGCAAACGCGACCGACCCCTGTAATAGGTAAACAGAACAACAGATTAGTGCACTGAATAACCAAACCAAACTTAAATCTGGTGGCTCTTA
CCAGACGAAGCGAAGGAACGATGATTTCTGCTCGGCGGTGAATTCTGCCAAGATGTCCCAGAAGTAGGCAATATGCGGGTCTGTTGCTAGACAGCCGTCG
CCGTATATGGTTCGCCGCCGTAGAAGAGCAATATCTACGGAGGCTTTGCCGCACACGAGTGTCCGCAACTCATGCCACGAGAATAGCCCCAGAGTAGGTG
CTGGTAGAATCGTTGCTATACCACGCGAAATGTCCCCACATACTGGCGCGAACTCAGTAAGACGGTATGTCTCGACTGCTGATGCGTACTCCTCACGATC
TTCCCACGTAACGTGCAAATGCTGTCCCCCAGGCACTAACTCAACTGTCTCCCGCGTACTGGATAGCACAGTAAAACTTGCATCCACGATCTCATCGAAC
ATAGTCTCCGTAATGCCGTGTGCATCCAAGTTCGCAATCGTGTCCACAACCTGAAAGCATCCCTGATGGACAGCTTCAATATCGTGTCGTGTTACATTCT
GCCCTACCAATAGTTTCCACACCACGGGCGGAAGATTCAGATCCAATGGTGTTTTAGTTCGCACAGCCACTCCTGCAAGTTTGCCGAGGAACTCGGCCAT
CTGCACCCGTCGCGGGTTTGAGCGTAAGTGTGAGTTTGGAACGAAAAGCTCACGGTTTTCGCCCGTGTTCAGCAATGCGTTGGGACACTGTCGAAGTACA
GGCAGCAATGGCGTACGGGTTTGCAACTCGGAGCTCAGCTGTGCCAAACACTCGCGGTACAGACCGCCGAAATCGTCTCCAAATTCGCCGACAAACTGGC
ACTTGAATGCACGGTCAGCCCCACGTAATAGAGCAGGTTGCAGTCCGTGAAGTTGCTCGAAAGTCTGGGCGAACACACTATCCCGCTCACCAGCTTCGCT
AGACAGCGGATCACCACGCTCCGATAGTTCCAGTGCATCATGAGCACGGTTGCGATCGACTTCAATCTCTGGACGAGCTGCTGCTGGAGCTTGCTGCTCT
TTGAGGACTCCGAGCCACCACGCAAGCTTCACGTGCTGAAAGACCACACCACGAAGCTCTCGAGCCCCACGAGCTAGCAATGAGTGCTCATCCTGGGCTG
AGAAGTCGATAAATGCCAGTGATGTCTGCAAACGGCAGTTGAAGTTACGTAACACCAAAAATCGGCGTTGGAGTGTCTCCAAGGGTACGCCTCGCAGTAC
CGGGAATCCCTGTAGTTGCTCTTCGGTTGGAACAAACTCCTCGGGAGCCATACGCAGTGGGTCACAGCTTAATAGCGCCTCGGCACGAGTCTCGCATATT
TCGTTTACGAGCTGCACAAGAGCGCGATCCCGGGCTGGGGTAAATACACGCTGGGATGCGTGCAGGTGGCGAAGCTTATCACCGTACTTGGTCGCTAGTA
GCCGGCGGCCTGTTACTGAGAATTCTGGGACGGCAGTGAATGCAACACCCCACTTGGTGTCTCCGGACGACTGCTGTTCCTGCTGTTGCTGCAATAAACT
CGTCACATCACCAGTAACAACCTCTTCAGCGGATCGAACCGCGTCAGTATCTCCCTGAGCAGGGGGCGGAGGTGGAATTGTGCTTGAATCCAATGCTTCA
TTTTCTAAGTCCTCAGACAGCGATAAGGATTGATCATGCAGTAATTGACGGTGCCGTGCGCGGCGTGCCATTGCTTCTGCTTCTTCGCGAACGAGTGCCT
CCATTGCGTGCATGTTCGCCAGAATGAAGTCAGCAGCCTGCTCTGCATCGTCTTCACAGTGGCGGAGCGCGTAGACGCACCATTCCATAGGGAACCCCAT
TTGGCTCAACGCAATTCCCAATTCCATTCGGAAGTTTGGAATTGAGCCATCACCCAGGCTTCCTTCGCCAGCAAATCCACCGAGAGTGTCTTCTTCTTCT
TCACTGTAGTAGGAATCCTCCCCACTCACCAGTCCGCTACCGGTTCGAGGTAGTCCCGGTTCAAGACCCCCATCCTCGACTCGGTGTCCACCGATAAGAT
CGATGGAGTCTCGCTGGTTGTACAATGCAAATCCAGGGTAAAACGTACCCTCAAGTTTAGGCCCAGTTCCACCAGGACCAAACGCAACACCCAAGTCCTT
TCCATTGAGTGCGTAGCTAAGCGTACCGCGCCGCAAATCAAGCGTGAGGCGGACAATATCTCCAGTCTTAAATTTGTCGCCGTATGTACCACGCTGCTTG
CTGCCATTGTGCCAAAGCGCACGATTGCCAATCCAGCCCCACCCGCGGTTATCTTTGCCCAAGTAGGAGTCTAAGCGTACGTCGCGACGAGCAATCCCCA
AGAAGATATTTGAGCTTGCTGTCACAAACGTAATGCGTACTTCCCAAATGTGCACACCTCCATCAAAACGCGCCACACCAATACCTGTTTGCCAGCCTTT
ATCACGTGCGAGAGAGAGCCGAGTGTCTCGTGCTTCAAGCTTAAGATATGGGCCTTTACGCACACGATCCACACGACACTGGAAATTAGACTGCACGGGG
AACCGCCACACAAAACTGTCTCCATCGATGGTGACTTCCTGCCCTCCGCAGGCCCCTGTAAATGCACGCACTTCTGCTTCGCCTCCTCCGCTGCCTTCAG
TGCCTCCTTCACTTCCAGCAGCATTTCCACCCTGCAGGATCTGCAAGCAATGAGAGCTAGCTGTCTCACTCTGAGGGTCTAACCGCACGCGAATACTGGT
AGCAAGCGGGATACTGACGAGTGACTCTTGTAGGTCGAGATCGTATGGATGTGCACTCTCTACGCGAATACACACATCCTCTGAAATGTCTGACAAGAAA
TTGTCAGCCGAAAGCATAAATTCATCGGGTAACTGAGCCTCAATGGCAGGGTCACTTGGTGTCCCTGTCTTCTCACCATCAGCGTTCACTTCATCAGACC
TCGCGGGATCCATTAGCGCTTTCATCACGCCATAAACTTGACTCAGAGGCTCAAACCACTCGAAAGCACTCATAAGATTATCACAGTCAAGCGAGTGGAA
GCGGAAACTGAAGTTCGCGTTCTTCACTGAAGCTGTCGCTGTGGCACCCAGGTTGGCGAGCAATTTGCAGTCTGCGTTGAAAGAAATGGTAGGGTGTAGC
AGTTGTGGTCGTGAAATACTCGAGAATGCAGTACCCAGCAGCTGGCCATTCTTGCAGAAGAAAAGCTCTTGAGTATCTAGGCGCAAACCACAGCCAAAAA
CATCACCAGGGCTTACAGCACCTGCAGGTTCAACCCAGCGCCAGCGATCCACAAGAGTGTCACCAGCACACAACGCTTGGCCGTTTGCTGGAGCAAAAGA
GTAAGATCGAGAGCCGTCAGCACTGCCGCCCACCAATACTCCTTCAAGTGGGAACGACGGTGGTGAGAAACCCAGCGCGAGCGAGCCTCCCATTGTAGTG
CTTGTGCCCCACTCCACGACTGTGACTTCGAAATACACAATTTCGGCTTTTACCTCATCTCGCATTGTCATCATGAGAGCTGGGGTATGTTCGAAGCGGC
AAGAGTACACCTCTCCGGGAGGAACACCAAGTCCTTCAGCTGCCAACGCTTCTCTCGCCGCCGTGTTGCCGCTGTCTTCTGCGCGATAGTCTAGCAAGAA
TTTACGCTCTTCGCCAGATAAATGACGACTGACCGCCATTTTGGAAGAATGGCTCACCAGCATCTCCACGAAAGGCTGTTTGGAAAAATGGAATCGGTAC
GGTAGGCTCAACGAGCCCCCTCCATCTCGTTCTAAACAAGCGGCGAGCTCTTGTATACGCACACCGCGTTGCTGATCCTCGACAGCAAGCATCAACTCTA
CAAACGCCTGCAAAAGAGCATGTAACGTAAATCCGCCGTCTTGGTCTTGGCTCAAAGCCATAATCTTGGAGCGACAATAAAGTAGAGCTTGCTTGTCATA
CCAGTGTGCACCACGCTGGATCACCGTAATGAGACCTCGTACAAGTGCGACTGCAGCCTGCCCACTAGACGGCTGGTTTTCACGCAGAACTTGCTGTACG
AGAGTAAACAGAGCCGCCGGCAGTTCGGGGCGTAACCGTATTGAAGTATTTTGTTTCGCCGGCTTGCTAGATAGCACCCGCTGATATTGCAGTAGCAGCT
CGAGGAAGGCGAGCACATGGTCCACACTTATTGGTGCACACAGAACCAAGTCTTCATCTGAGAGACTCACCGCGAACGCCGTGCTGGGTTCAGCAGCGCT
AGTGTCATTCAGTGTAACAACCGGTAGAAGCAAACCAGTGCTAAACTCCGACTCCACTGCCCAAAGAGACGTTTGAACAACAACGTCGTCAGCAACGGGC
AGCATTAGCTGCATTCGAGAAGAATCAATCGCCTGGTTCTTGGTGTTACGACTATGTGGGGTCGGACCATTCTCGCCGGTGGCATCTTCTTCGTCTTGAG
CTTCATTCTCGACTTCAATCGTCGTCGGAAGCTCAACACCTCCACCCCCTGTGGAAGCAGGTGAAGCTGCACGCCAAACACAGTGAAACGAATTAACACG
TTTCACAAGGTCTTCGCGAATACAACGTGTGCTGGAGACATCTGGAGGCTCAAAAGGGTCTTCCTTGCTTCCTGCTACGCATCCTAATGCTACGTACCCA
GCTGGTGCAACAGGCCACCAGATAGAGCGCAGCTGCTTGCGTTGAAAATCCGGATCACTTTCGGAGTTCTTAGGCAAGCCTTTTCCAGTAATATCCACAC
GCTCAAAGCTTGTAGGTGGGGCCAAAAACTCTTGCTCATCGTTATCGTAAATCAGTAGCATTGGTGCATCAGGAGCACCGTTACCACACTTCACCACATC
GCCAAGGCAGAACCATTTATTGGTAGTGTCCGATGCAGCCTCCGGCACTGGAGGTAGCGTCGGACGCCAAATTGTCACTGCATGATCTGCAGCAGACTTC
ATCCAGCTATTGTCACTGCCGAGTGAAGACGCGAAGCGTTTTCTCCACTTGTGGCGATACTTTAGTAGTGGGTCAGGTGGTGGAATACTCCACAAGCGCT
CGTATGTGTCAACCACCATGACTTCAAGGCCGCAAGAAAGCAGCACAGGTCCCTTCGGGAAGCACCCGTCCGTTTTCCGATTTCGAAGAGGCGAACTTTC
CCACCCCAGTGCAGTGGCTGGTGTCGCATGCGTACGCGAAAGAACATGCAAGATCGTTTCGAACGTGATTGCATCCAGTGTGTTGGGCTGGTACAAGTCA
TTGACATCCTCTCCAGCGTCGACCCTGTTCTGATCATTCTCAACAAGGGATTCAACAAGCTGAGTAATGCCAGACCAGCCTAGTTTTGCAGGGTGTTCCA
TGACTTGGTCGATTGATCGCTGCACAGTTGACAAATTTTGTGAAGAGAGCAGGTTTGATACCAAAGTTTCTGTTGGAGAGCGTGCCATCACTTCGCGCAC
CATGCGCGATAGGATCTGCTGAATCTTGCCGTTCTTTTGCGCCTTCGGTTGTTGATGCAACTGATACTCTGTTTCGTGCTGCAAATTCAAACTCGCTTGA
TGGGGAACGCTCAAAAGCGTAATCAATCGCCGAAGTACCAAAGGATTCCCAAGATCACTGAGAGGTGCGTCTCCGGTCTGTGAGGCATTTCCGAAGAGCC
GTACAATCTGGACAAGAATTGTGCGTGCATGAATAGCTGCGAGGCGCTCACATAGTATCTCTTCTTCACGATCGATCTCAAACGCGTTCATTTGTCGTAC
CGCATCGTCAAAACTGCTGTTGCATTCGCTCCAGAGCGTTAACTCTGATTTGCTGAGCATCAATTCCAAACCGGCACCACCAGCGTTATCCATCTTTTTG
GTTTTAACAGGACTTCCCATCGCTCTGCTAGCAGCACGGGGAGGCACAGGAGGGCACAGTGCACTGGATTCTGTGAGAGCGTAGCTTGGGTTTTCGTCTC
CGATGTCCTGAAAGTTTACCAGCGGCTCACTAGGCTGTTCCGCAAGTAGGGTGGCATCCGTTGTAGTGAGAGATCTGGGCGATGACACTGAATTTTCCAG
TTCTGCACTTCGGCTTGAAAGTAGTAAGCGTAAAGCATCGCCGTAGCTGTTATCTGTTTGGCGTAGAGCTTCAGCGCACACTGACTCAGATCGACCAATA
ACCATTGCTAAGTGGCGCACGTTTGAAGGGTAGCCACGCTGTGCGGTGTTGCAAAGTTATAAAAGTAAACGTTAGACCTATCATCATATGCACTTCTCGC
AAAAATACTATAACAGATACTTACCAAGTGAAGCCCACGACTTTGCTGAATCACTGCAAATGCTTCATCCAAGACACCAGCCGACATGCGAAGAGCTTCT
TCGCACTCAATCGCAGTGGTCACTAGGTTGGCTTCTTGAACCCGTGCAAGAAGCCGAAGTGTAAGTACTTGCACGTCCTGTAGGCCTGATGCCGCATTCT
GTTAACACGATGACAAATCGTTAAATTAAGTGCTCGCATGATGGCAAATGTGTGAAGAATGGAAACGTACTGAAGGTGCAGCCAAGCCTGTGTCACCGTT
GGAGCGTAGAACGCGTGTCTTCGCCAACTCAATAGGAATACTAGGGCGCTGTAACGATGACTCACGGTTTACGCTGTCGCGGCCTAATGCGATACGAAGC
ATGGATCCCACCCCGCCTTCCTGGGCTCGAGGCGATGGGATAGCGGTGGGCTCATTCGGAGCGAAACTTTCGCGCTGCTGGTAAGATGCCGGAGACAAGA
TGCCTGCTGGTACCATTGTGGAGTACATATTTGCTGTTGGGGGTCCTACCGTAGGTGTACCTGGGGCTTGTAACAACGAAGAGCGTGGGGATGTGTAGCC
ACCAGCTCGAGGTGAATCCACAGCAGGATTTGGTGAAATGAGTGCACGAGGGACATCACTCTCAGCAACAGACGTTATTAAACGAAGCCCCTGGGTTATC
GCCTGACGAGTCTCCGCTGAGGTGGTATTTCCACGAGTCCCGCGATTCTGCAACTCCGCTGGGCTTCTCGATACTACCTGTGGTGTACCAAGTTGTGGCT
GTTGATACTCCTGGCCGGGGATCAAAATGTTCAGATCACCTGGGTTCTGTGGCGCAGTGACGATAGGAGGCGGTGCGTGGCGACCTCCGATACTACTTCC
AGGGGCTCGAACCTGGAATTCATAAGTCACAAGACCACCTCGAGATAAAATCAAGGATATCCGGGACCCCGACGTGATCCGAGTGCTGGATCCATGAATA
CGCACACCATTTACAATAGTACCGTTCTTGCTGAAGTCTTGAAGCTCAAATTGCTCTTCACCTCCTTCCATTTCCCGCCGTAATCGACGCAAATGGAAGT
GGCGACCACTTACACTGCGATCGTTTACAATGAGATCACAAGCATCCGCGGCGCGACCAACCCGTATTATAGGAGCCGTTAGTGGAAACGGTGCATAATC
GATGGCCGAATGCCCAGCAGCACCAACAGCATGTCCGTGCTCATTTTCACTCAATGGTGGCAGGGGAAGTAGTACACCCCATGCCCCAAATGGAAGATCA
CCATCTCCTGATCTGTTGGGCCGCTGTGCAGCCCCACGCAATGCGCTCGATCCGAAACCAATTGGAGCAGCACCCGCAAATGAGGGGTGACTTATCTTAC
GGCGCGGTGACTGTATGGCATCTATTCCCCAGCTTAAAGCATTTTCGCTCCCCAATTTTCGAATAACTTCGTCGCGCATTTCATCTTCGTAATGATCCAA
AGCAACATCGATCACCTCCTCAGTATCCAAGAATATTTGTCGCTGCTTTACGCATAGCCATCGTTTTTGGAGAGCGCGTGCTGTTTCAAGCACTACTACG
TCTGACTTTCCTGCCCACGACATCGAGTTCTCAGAGGAAAGCAACGTGACCACGCTCGTTACGAGCTGTGAGTCCAAACTCATTAACGTAGGGCTTAGAG
TTGTAATCTGCTTCAATAAGGATGACAACGCCTTTGATGACCTCCATCGCATTTGCTGTTTGTACATCTTGAGTCGTCCCCTCAATATTTTCTGCACCGA
ACTGTTCTGGGGAAGTGACAAATCGTAGTGCATAGTACCCTCTTCATCAAAACAAGAAAGTGAAGAAACCATCTCCGATAGCGTCGTGATAATGCTTTCT
ACATCATCGAACATGTCCACAAGAGCTGGGATGCGCTCGACTACCTGGAGCTTGGAGAGTGGGAATGTCTGAGTTCGTGTATCTGGTGCAATCAACGGAG
AAATGGAGTTTTCAGGACTGGAATCCACAACTACATCTGCTAAGAGATCTGCTGTGCGTGGATCTCTCGTGATTCCGGAGAGGACGCCCGCCCTGCTCGA
ACCTTGGTCCCCGGCGCCTTCAATGGTGACGGATCCGCTTTCTCTGAACATTTCAATGTGTCCACCAACAATGCTCACTGCCGCAAAAACTGTAGCCAAA
CCCTCAAGTGCATCTTTGGCCTTTTGCCAGAGCATTAGCGAATGCTTATCTCGAGTAATTGTCTGTGCTTTCTCCGTGTCATTAATCGAGTCGTCGGTTT
CTGGCGACGAAGTAGTCGACTCGGGTTTTCTTAGACCCGTGGAATCATTCTCTTCCTGGAGGCCATCAAGCACTGCGGTTTGTAGAGTCGTGGTGTCTGC
TTCCTGGATATTTGTGTAATATGCACAAATGGTGTCCAGCAGCTCGCATACCTTATCTGATTTCGTAAGCCCTCGGTTGATGGCGGCATTGATCGCGACT
TTCCAGGCTGGATACAGCGTAAGATAGCGCAGAAGTGCGACGG