Description :
From Genome Similarity Track
Location :
Scaffold_20:103558- 105097
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_20-snap-gene-1.10Ubiquitin carboxyl-terminal hydrolase

Sequence
1539 bases(100 bases per row)
ATATCACTCTTGTTCCGATTTTTtCTGTTGTGCTTCTCCAGTTTGTCTGCTTGAAACGCTGCAACTGAATGACAAGTATAGGCGGGGCACGTTGAAGCAG
AACTTGAGTACGACGACTCGTCTTGTCCTTGCAGTGTCCATCACAGTATACCTGATTGTCTTCGACGAGGTCCTCGAGGTGGCGATGGTTTTCAAGACAT
TCTTCAATCTTCTGAGCTGCCTTCGAAGAATCAACGCACAGCGATAAgACTCTGAAACACAaCACACTTAGCACTTCAAGTCAtCCcAGACCGCCCCTCT
TCCCTCGTACCGAAACTCCTGGTGAAGACAGGTTAGATTCGCGCAACTGCAACATTGAGAGCCACGGACAATCTGCCCCGTGAACATATCGGAGATGAAA
GACGCGTTTGCTTTCAAGTATCGAGACCATCGGACGTCGCCCAAGAAGCCTATGGGAAACAAGCGCATTCGTCAGATTGTACAAGCAGTAGTACACGTGC
GAACGTACAAACAGTCTGATTGTAAGTCgCAGGCTCAGTCACTACGCAGGTCTTGAGCTGCTGTTGGCATTCGGTCTCCAACTCCATCAGCCGACTCAAC
TCAAGTAGCTGTGACGCCTTCGACGAACTGCGAGTCCCCTCACTGACATGTGTACCTGTCAGCTCGACGCGTAGGAGTTCATGTAGTGAATCCAGCAAAA
ACGTGAAGAGTTCCTAAGACACATGAGTCAATAGTCTAACACCATGAGCTGGTTGGtGTACGAGACGACGATACCTCAGCATCTTGTTGGTCTTGGCGCC
TAGCGTCCGATGCGACCAAGTCCGAACACTTGCTCGCTGCCTGTAAGAATCGGCGCAACCGCTTTGTTGTACCGGCTGCTGAATAGTCATCAGGAGCCGT
AGTGAAAACTCTCTTTCGCTTTCTATCTCGTGGTTGATGTGTCTGGACTGCCAGCTCCGAGTtTCTATCACCAGTCTCGGCTTGAGAGGCATGTAAAGGA
TTCATtGTCCCACTCGGGCGATCACTTGGTGCCGCTGAAGTCGCTTCATGGGTAACATCTTCCaCCTCAACCTCTGGTAGTAAGCCTTGCAACAGATCAA
GCAACGTTATTGCCAGTTGCATCTGCTTCTCATTACGTGCAGCGGACTGGGAATCCCGTACATGTCGCTCTTCGTTGGACTTCGATTCTGTCGAGCcTCG
TTCATCTAAAACGCGTTGCACTTCCTCTTCAAGTCGGTCCACGAATCCAGGAAGCGCGAGAATACATTGGACGACAGCATTCACAAaGCAAGTGTtCCCA
GTATTTCTCAGACCCATTCGCACAGGATACTGtcTCGAAGCGTGGAGCTTTGCCTTCAaGTCCACGCCTGTCTCATCACCTTCAGAGTCTCTCTCTTCAT
CCTGATCTTGGCTTTCTTCTTCGACACGATCAATCTGCAACCATCGTTGTCGTCTCCTCCcAGCGCCACcTCCTTGCGTCGCGGTGGTCGATTCGGAGcg
TCCGGCATTTTGGAGAAGCAGTCGCCgAGGGAACAGcGC