Description :
From Genome Similarity Track
Location :
Scaffold_554:1035- 3199
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_554-fgenesh-gene-0.4Protein serine/threonine kinase

Sequence
2164 bases(100 bases per row)
TTGCTGTTGGGTTGCTTCAGGTACTGAGCTTGCAGGGTCATCTCACTCCAGACAGTTGAAGAGATATTAAACTAACTCGTTTAACTCTTTTCCCACCAGC
AGCGCTGGTCACAGGAATCGTGACGAGCCCCATCGAAAGGTGCTGAACACATCATGGTGCTGTAATACAACCCTGAATTTCAGTAGGACGTCCTGGATGT
ACGCGCGTAATAGAAGCGAGTGTCCCCACAGCTCACTGAACTTTTCGGCTCGACACAACTCACTAAACGGATTGAAGAGTGCTACATACCAGTTGAAGCT
GATCCACTGAACTCACGACGAGGGTATCTTCAGATCTTGAAGGCATTCATTCGGCAGGGTTCATGAGATCGCCAGCGCCGCGATCATGGGGTAACTGACG
TGACCGACCGCAAGTGTCGTGAACGTACTACACTTGCGTACTATCAATACGTAGTATGATCGACATCAAGGTTTCAGAATCCACGTGGAAGGCAACGCAG
GCATGCAATGAATCGCGTTTTGCTGGTAATGATTCCATTGTAGTGTTGCGAAGAAGCAGATAAATATCATCAAATTAGAGAGATTGTCCCTCCATCTACA
GAGCCTCGAATCGCACGAGGCCACGCGTGCACCGTTTACAGGGTCACGGGACATCCCTCTCAAAAGTCGTAGACCCAAGAGTCCGTATCCGAGTCCGTGT
CCGACAGCAGCGCGCTGTCCTCGATCTCCTCTGGGAGTTCGCCATCGTTGGCCTCGAGGAACGAGTTCTGGATCTCCTCGATGGGGGCGAGCAGCTCCTG
CTGGCGGCGATAGAGCTGCTGGAACTCGCGCGCCTTGTTTCGCTTGTTCAAGTGTTCGCTCAGTACGTCGTACCACGTGTGCATCTGGTCCTCTGTCTTG
GCCGACATGCAGAGCTTGCGGCCGCACTGGAGCTGCACGCAGAGCCCATTGCGGACCTTGGAGTAAAAGTGGACGTTAACAACCGCGTCGCGACGCAGCA
CCTTGGCGGCGTCGCGGCTGTCCTTGCGGTAGCTGAGGAATCCATCCTGGAACACAAAGAATCGCTTGTGCCACGTCTTGATGCGGCCGCCCTGCTTGAC
GAGGTAGCCTTCGGCGTAGCCGTCGAGCACGAGCACAGAGCCAGAGGTACTACGGCGCAGTCCGATCATGGTGATTAAAGTTGGTTAGCTTGGTCGAGTG
TTGGGGAGGCGTCGGATTGCGAAGTGTGCTGGCTGCCGAAGTGGTAGCGGAGACCGAACGGGCTCTTTTGCCCCCCACGTCGCAGATCCACTCGACCAGG
TGGACGGGTGGTGATGGAAGGCGCAGGGCTTCAGCTGATCACGGCCGTGAGATGACGGATGAGTTGAGAAATGGATTCCTGTGGGACTTCGAACGTCAAG
GTTCCGTCCGATTCTCTACCACGCGAGTCGCTTGTGGCCAGAAGCTCCAAGCGGGTAGAACCCGTAAGTAACTCAGCTGGACAAAAGGAAGCCTACTGGC
TACCTCTTCTATCAAAGACAATCCGACTGATTCCGATTGGATACCATACATCTATCAAATGATACAGGTTTTTGGGACTATAAGCGACCAGATTCTGACC
CAGTGGACTGAACACGGATAATGTTTCAAAGGTTGCAGAACTTTTCGGCAGACCGTCTGCTGAACTCTAGAACACGCTTCCGCCCGCGTTCTGAACGCTT
GGTCTGGCTATCTTGGGCGTGAAAGGGATCTTCCCATCTTTCGATCGTCGCGATTGAGTTCGGAGAACGGATCCATTCTTCCGCCACATAAAGCAGAGAG
CTTTCTGAGTGGAAACTCGGAGCTCCACACTTTTGGTCAGCGGGTCCGGATCAGACCGTCCGCGCTGTGATCTTTGAGTTCTGTCTTGCCCCTTCTTCCG
CCATTGTTCAGACGGCATCCACAAAAGCACTCTTGCTCTCAACCAGGTGCATGTCTCCCCACTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTACGAAGCCCGCCTCATACGAGAAAAACAACCATGCGAAAAT