Description :
From Genome Similarity Track
Location :
Scaffold_110:10349- 11804
Transcript NameFunction/comments
Sapdi_VS20SDRG_16018hypothetical protein

Sequence
1455 bases(100 bases per row)
GTCAGGCATCAAAACGCTTTTTCAAGATGCTAACAATGTGAATGTAGCTGGCTCGTGTCTCATGCTTGCCGAGTCGTGGATCCGTTGCTGTTGTATGACC
TCTTAAGCCCGTGTGATTCGACACGATGCTGCCAAGCCATGACCGTCCCTATTATCTTTACCGCAGTCGTGTCGCAGGCGTTTCCGGAGGGAGACAGTGC
TGGGAAAACGATGGAGGTCTGGGCTGGTCCTGGGAGGTGACAATCCGGATACACTCGCCAATCTTGAGATTTGTATGCTCTCGCCGGTGGCACCGGCGTG
AGTAGCGGCGCCAGCTGCCGGGTCGCCCCAGTTCCAAATTCGTTCCTAGGCCATCGCGATGGAGCCGCTCGACAAGACGATGAGCGTGAACAGGACGATC
GGGATCAACTCATCCGCGCATCGTATGATGTCCTTTGATGAAGCCACGGTCATTCGGCGCTGCTACCAGCGCAACAACCGGAAGGGCGGCCAGAAGAACT
TGCGCTGTTTCCCGAACTGCTGCCAGGGCGTCCACGCAAGCACTGGCTACTGCGGCGGGCCCATCGTCGTACACTTGACGCACCCGGTCTTGAAGAAGGA
CACCAACTACATGCTGTTTGCCGAGTTCTGCCCCGTCGTGAACGGCGTGCCCGACGGCTCGTTGCACGAAGGCGACGTGTGGCCTGTCGAGAAGGCCCTC
TCGCTCGCCCACAAGGAGAAGAACCCGCTTCTACCCCTCTACCAGGGCTCGCCGATGGACGGCGCACCGCACGCGTATTGCTTCAACGCATCCAAGAAAG
GGTGGCACTACGGCTTTGTGAGCAACAAACACGTCTCGGAGATGCACCACGTGCTCATGGTCTACCTCCTCGAGCGCGGACCAGACGCGGCGCTTCACTG
TATCGACACACTCGTCTCGGTCTCGTTTTCTATTTATTGTCGTCGCCGCGCCAAGACGTCGCGCCTCGGCGAGCTGCTGTCAGCCGACCCGGCGCCGCTC
GTGCCCGCCGACGAGCGCAAACGCAAGGACGCAACGATCGACGCACCCAAGGTTCGGCCTCCTTCCCGCAGTAGCGACACGGACTGGATGATCTTAAATG
AGCTTCTCTCGGAGACGACGCCGCACGACAAGGACCCGCCGTCGTCGCCCGAGACTACGTCGAGCCAAGAAGACGAAGATCTCCAAGTCATCAAGCGTAT
CAAGCTGCCACCGTCGTCATCTTCCGTCGTAAAGGAAGAGGTGCCATCGCCAAGTGCGTCGCCAGCAGATACAACAGAGTTTGTCGCGCCGCCGGGCTTC
TACTCGGTCGCGCAGGTCAAGGCCGCGCTTGGCATTGCTGACGTGTTCAAATTTCCGCCCAAGAACCTTCGCGCAGTGGACGTCGTCACCAAAGCGTCCT
CAGCAACGTCCACGACTTCATCGACAGCAACTTCGACGGCGACGTCGACGGCGGC