Description :
From Genome Similarity Track
Location :
Scaffold_710:10349- 11540
Transcript NameFunction/comments
Phypl_g10476hypothetical protein PHYSODRAFT_328874

Sequence
1191 bases(100 bases per row)
TGTCGACCTTCGTTTGCGCGCTGCCTCGATGTGAGTCCGCTCACCATTCAGCGCTACAAGACTCGTCGCAAAATTGCCGCTAAGCCGCACGGAAATTGGC
TGAACAAAAATGCCTCGTCCGTCGATGTTCCGTGGTTCATCAAGTGGTTCAAAGAGTTCGCGGAATCAGTTGGTGAAGTTGTCCCCATTCGCGTGAGACT
GCAAACGACGGTCGATGGTCAGGTGAAGAAATATTACAGCTGAGAGGACTACACGTTGTTGCCCACCCACTTCACGTGGGACTCTGTgtacgacgagatg
cacgCCTACGTAAGCCAGATCCGGCTGCGAGTGAGCGAGCCTGCACGTTCGACGATGCGTAAGCTGCTGATATTGCATTGCCCGCATATTCGGATCCGTT
CTGTGCGTTCGAATGTGTGCGACGTGTGCGCCATCTACCAGTCCCGTATGCGCAGCGGACAGACTGGCGAAGAAACAGAAGAGATGGGAGTTCATACGGC
GTCAGCGCGGGAGATGCGGTGAGCCTTATTTGATCTGGCCATTGATATCATTTTGTTCCATTGACCGACTTTCATATCATTTCGATTACCTGCTAACATT
CTGGAAGGAGTACAAGAACGACAAggctggagttgctggccCTAACCCTGAAACGGACGTTGCAGTTATTGTGATGGACTTTTCCCAGAACCTAACAGTG
CCTTCAGTGTCATCGACACCGTCGCAGTGGCACTTCTGCTCTCTCGTTGCGGTGAACGTCTTCGCTATATTTTACGAAAACTAAAACATGCAGACAAACT
ACGTCTACGATGAGATGGTAAGCGGGAAGGGCAGTGACCAGATCAACGCCATGCTCAACCACTTCATCAAGACCGTTGTCGCTCcaggcggcaagaagaa
gctaGCTGTGTATGCCGACAACTGCGGCGGCTAAAACAAGAACAATTTGGTCATCAAGTTCTAGCTGGCTCAGCTTCACATGGGAGTGTTGGAGCGAGTG
GACTACAAGTTTTTCGTGAAAGGGCACACGAAGAACTCGTGCGACCGAGGCTTTGGGCATATTCGCAAATACGTCGCACGTCAAGACTGCTGGACGCTCC
AGCATTTTGTGGCAGCTGTGAGGGCCTCAGCGACGTCAAATAGAACGGTCTACATCTCCCGTGATGACGGTTTTTTTTAAGCCTACAACCC