Description :
From Genome Similarity Track
Location :
contig_12:103482- 105769
Transcript NameFunction/comments
g3142.t1hypothetical protein

Sequence
2287 bases(100 bases per row)
CTTCGCATGTTGTATCTCCACAGGACGCATACTTCATCGGCGGCAAGGTCGTCGAGCGACTCACACTGAACGGCTACTCCAGTTCCGCAAGCGGCTGCTT
CGGCATCTTCGACGGCCACGCTGGAGATCGCGCCTCGCGCTTCTGCGCCGAGAACATCTTCCCGCGGATCCTCGAGCAGCTCACCACAGAGTCCACCGTG
AACGACGCCATTACAAACGCCGTCCGGGCACTCGGTACGCTCGGCAAGCTGCTCCTTGTGTGTAACCTAGGCTAACATTTCTTCCTCCAGATGCTGACTT
CTGCACTATCGCTCGCAACAATTCCAACTCCACACTCGCCGCTGCCGCGCGGAGAAGCCACGGACGCTCGTTCGCCACGGACGACGGCTCCACGCTGCTC
GTCGCCATGGTGCGCGATGGCCTCCTACACGTCGGCAACGTCGGCGACTCCCGCGCCGTGGTGGTCACCCGCAACGGAGACGCCATCGCCATGTCGTTCG
ACCAGAAGCCCAACCGCAAGGACGAGCGCGAGCGGCTGGAAGCCAAGGGCGCGTTCGTCACGGGCAAGCCCGACTTCATGTACAAGGTGTGGCCTCTGAA
GAAGATGCTGGACGTCCCGCGTGTGAACGGCCAGCTGGCCGTGTCGCGCTCCATCGGGGACCTGTCGCTCAAGACCTACATCTCGTGCGACCCGGAGGTG
CAGACCCGCAAGATCTCCAAGAACGACCGGTTCCTCATCCTGGCGACCGATGGCCTCTGGGACGTCGTTACAACAAGATGGCGGCTCAGCTCGCGGCCAG
GTTCAAAGACCCACAGGCTGCCGCGGACGCTCTCGTCGCACTTGCACTGACCGACACACGGTCGACAACGTAACAGTCATGGTCGTGAAACTCGAAGCGT
ACGACTTCACCACCAGCCGCACGGACGTCAGCAACGACTGAGCTGGCACACACACAGCGAGTCGCATCGGGACGCTCGCTACTTCTACGCTAGCCACAGT
TATTTAGTCTGTCCTTAATGTTAATGCTGAGTTACTTCATCCGTCCGGCCAAATTGCTTTGTTGCCTTCGTCGGAGAAAAATCCATCATCCAGCTCATCA
GTCCACCAGTCACTATTACCTCGCAACAATGCCACCCCTTTTCCTGCAACAATGGGTTGCTATTTCCGGGTTAGGCGGTACTCTCCCTTCTCAAGTCTCA
TTTTCGCATACACGAGCCAAGTGGGACGTGCCTCGATGCCGGCGCTCGAGGTGTTCGGGCGCCGCAGCCGCGTGGTGGGCAGCGACGACCTGTTCTGCCC
CGCGACGTTCCTGCTGCTGTATCAATTGCCGCTGGCGCTGCTGTGCGTGCTGTACGCGAGCGTGTGGCGGCGCTGCTCGTCCACGTCGCTGGACGACCGC
GGGCTCCCGTTCTGGTACATTCTGGGCGCGGCGCCGCTGCTGTTCTTCCGCGGGTGCATCTACCTCATGATCATGCACGTGTCGGCCAAAGGGACCATCG
TGGACCACGAGCGCCGCGTGCTCATGCCGCGCATGCTGCAGGTACATGCGCTCTGGTCCGTTGTGCTCTTCGCCTACGGACTGCGGGCGTCTGCTGCTGG
TTCTACCGAGACATGTGCCACCCGGACGCGCGCTTCGTACTGGTAAGGGCGGATCTTTTTATAGATGGCTACTTTTGAGCGGTTATTTTTAGAGCTGATC
GGTGATTACTGCGGTGGAATGATTAGGCTGTGGGTGGGTTCCTCGTGGCGGAAGTGAGCTTCACCTTCTCGCTCGGCGTATGCATCTTGGGCGACGTACC
GCCTGAGGATCTGATCGACCAGGAGAAACCTCCAGTGGTGGCCGACACGCTGGACTCTTATGGTAACGCTGTTAATTCTGAACGCCAATCGTTATTGGAC
GGTACGTTGGGCCTGGAGACGGCCAACGGGGGGACAAACTTCACTGATCGATTTTTTGTTGCTCTTGTAGAGGCGGAGCGCGCGGTGCCGAGCTCCGACG
TGTATGTGCCGCATAGTCAGCGACTTTGGAAACAGCGATGCACGCGCTGCTGCATGTGCTTGCGCTGCTTCACGTGCAACTTGTTCGGAGGCGCTGGAAC
TCGCCACGACAGCATGTCCGTGGTGGCAAAGGTGTTCTCGAGGCTCTTCTATGGTAGTCCAGATCTTGTGATATCAGATATTGTTGCAGGTTTTGTACTG
TTGGCTGCGGTTCAGGCGTACGAAGACCATCACGAGGTCGTCGCCACGTCCCCACACAGAGAAGGAGACGAAGAAGAGGAAGAAACA