Description :
From Genome Similarity Track
Location :
Scaffold_133:103457- 108759
Transcript NameFunction/comments
Hyaar_Emoy2810675hypothetical protein

Sequence
5302 bases(100 bases per row)
AACAATAACAATACAAAAATGGAACTAGACAACGCTCAACCTCTTTTATCTTCCTATCTTGTTTAAACTGTGTATTTATTTTTGTATGTCCAAATTATCA
AATTAGAACACAATAACTCAAAAGGGCTAAACTCTTGAAACACCATTAATTTCAATTCTGTCTCTGTTACTAGTCTTAAGTTCACATTCGCTTACCACAA
AAGGAGTAATGACTGTGGTTGTATTCTGTACCACTCACTTAAAATTCTAGATTCACATCTGCTCACAGAGACTCAGCACTAATCATTTAACAAGAACAAC
TGCTAAAACTTCAAACTTTAACAATGGCTGAACAAGGGTTCATCAAACACCTTCCAAGTGTTAAACACACATAGCATATCAGATGCAAAAAAGATCAATT
TTTTTCAACAGCATGACAAAATATGTGCAGATGGGTGTCATAAAACATCAAGAACATGTCAAATTGAGAGACTTTTTTCCATATTATTCAAGAAATGTAA
TCTTCATATATGCAAAGGGGATAGAGAAACAACCATATACTGCGAAAATAAACACTTTATTAGCTAAAAAAGGGAACATACCTTGATTTTATCTCCTTTA
ACAGCCGTCACAAGTGATAATCAGTGAGCATCTAGTAGCTCTGAGTGTGTATTTTTTTTTTGTAAAACCTTTTGTTCTCTGCAACAATAAATGGAAAAGG
GTTTATCAAAAACAAGAAAACGATAATCCTTTTTGAAGTTTAAAAAATAACAAAAGTAGTCCCATATGTTTGTTTTAGATTAAAAAATAGTCCTTTTAAT
ATCATTTAAGAAATTATAGTCTTTTTTTTTCCTCTAAATTTTGGAATATTTACCCAAAAAAATATTTAATCAAAACCATTATAAATTTTAATACAAAATC
CTAAATCACAATGTAACAGAAAAAATCATGCCTCAAGGTATTTGAAAAATCGTGACCTAAAATTATGAAAATACTAGAAACTTATAGATTATAGACGTCG
AAGTGTAATGTTACGGCGACCGCCGAAAAGAAGCATCTTGCAGACGAGTGAAAGGGAAACGAGAAAGAGGCAGAGATTGTTAGGTTACTTTCGTTGTTAT
ATAGAGAGGGTTCGATGTGGGCTGGACTTTTTTTGTCAGATTTTTTAATTTATTTTTGTTGAGATTTTGGGTCGATTGGTTAGAGCGATAAATATCTATG
AATAAAAATTTTGACAAAAAAAACTATAACAGATGAACTTTCAAATGCAATTTTTATTTAGATATTTTTATTTTCATAATTTAAAAATATATAATTAAAG
TAAAGAAATATTTTGTGGAGGCAAAAACAATTTATTTTTGATAATACTTAAATAAGCAAAATCATACTACCAATACTTTAACTCTTTAATAATTTTAGCT
GTAAAAAATAATAAAAATCGAATCTAAAAAGTTTTATCAAAGACTCTTTATTGAGGGATTTATTATTACTTAATCTTAAACTATATCGAACATGTTATTA
TTAATTTTTTTTTCTTATTTATATTTAATAAAATAAAAGCACAACAAAATTCTAATTTTAGAGTGACCAAAGTAGTGTGTAACTCAATGCTTGTGTGGCC
TTTAGCTAAAAAGTCCAAAAATTCATCAAAGTATATAAAATAGAGTGACATTTGTGTTCATTCAAGAACCTTCTTTTCCCCATTTCTTCATCCCCAAATC
CTAATACATTTTTTCCCAATTACATGGATGGTGAATCTTGATTTTCTGTGAAGGATAACTTCACCTTGTTGTTTATATAAGCTTTTTAGCCGGTATGTGT
TCTTGTTTCATCTTCTTGTTTTTGTTTTGGGTGATTTTGTTTGATTGGTCCGAAATGTTCTTAATTGATGCTTGTTTTGACTTGTGAGCCTTTTGGGGTT
GACTAACATGCACATTCTTGATGAATTTCACTTGGAAAAAAAAATGGAAGTATGAGTAGATATCAACTAGTTAGAGGGAGGGTTAGTCTGTATCGACCTA
AAGTTTTGTAATTTTGGTTGAGATTGATATGGTATGTGTGTAAAGGTGTGATTTTTATAGAATTTTGTTGTTTGGTGAAAAAAATGTAACTGATCCCAAA
TGAAGCTGAAATGATATCGAGTCGAGTGTCTATTGGAAACAATCTCTCTACCTCCCAAGGCAGGGGTAATGTTTGCTTGCACTCTACCCTCCCCTGACCA
CGCTCATGGGATGACATTGGGTATGTTGTTGTTGTTGTATAGCCTAATTCAACTAGTTGGGGGTTGAGGCATGGTTGTCTGACTAGTTGCACATTCTTGC
TGAATTTCACTTGAAAAAAATGAAAGTCTGAGTACATATCAACTAGTTTGAATGAGGGTTAGTCAGTTTCGACATAAAGTTTCTTAATTTTGGTTAGAGA
CTGATATGATATGTAGGTAAAGGTGTGATTCTTATAAAAATTTGTTGTTTGGTGAAATGGAACTGACCCAAATGAAGCAAAAATGATTTAGAGGATTCGT
ATAAGCCTAATTCATTTTGTGAGCCGAGGGTATATCAGAACCAGCCTCTCTACCTCCCAAGGTAGAGGTAAGGTCTGTTCACACTCTACCCTTCCCAGAC
CCTACTCCCGGGATTGCACTGGGTACGTTGTTGTTGTATAGCTTAATTAAACTAGTTCAGGGTTGAGGCATGGTTGTCGGTAGATTATATTTGCCTTTGA
GCTACCACTATGTTATGGTTTTAACTTATATTGAATATCTTGAATTTTAGCTTGTGTTATAGGAGAATCTAAGTGAAACGTGAATTAGGTTCCAATTCAG
AATGTTGAATGCAACAATAGACAGTTGATAGTTGTCAAAGATGACTGAAAAGAAAAACACCTTCGACTAGTAGAGTTATAGTATAATAAAGAGTAAACAA
GTAGAAAGGTTTATTTTGGCAAAATCGGGATAGTAGTTTCTTTATGATGCAAGCACACTTTCAAGTTTCAAAATTTCACTTTTTATTGGGTATTGCACAT
TTATTGAAGATGTTACTTGTGCCTTATCTTTTGTTTTTTCATCCACAGGTTGTTAATTGAAGGAGAGTTATTGAGAATAAAAAAAAAAGTAGCTGGTATA
AGATAGCTGCAAACAGTAAGAATATCTCAAAACTACTTCATTATTTTCTATTTGAAGTTTATATTTACATTAACGACTTTTAGTTTATATTACCGCCCAT
GGAAAGTCCAAAGGTATATCATATGAAACTTGCATGATTTCCGTTATATACTGGAAAACCTTGGTGCATATTTTAAGAACAGATAGATATGGTTGACATT
TGTTTCATTCAAAACTTCTGGAGAATGATCCCTGGGATGGAAGTGTACACATACTTCTTGTTAACATGAGATTGAAGTATCTTGGGCTCTTAGCCAGCTA
CGTATTTATTTAGGAAATGCGAAAGGTGGACCCTGTAGGCAATCACTCAAGTTGTTTCCTAAGGAAATGTGAAGTGAGCCCTGATGTGTCTCAAATTGTT
TCTAGCTGACAACCAGCTCCATCACTATTCAAGCTCATTGTCGAGTATGTTTGGTTATGACTTAGTGAAATTCCAAAGGGAGGTACTCATGTATATTCAG
ATGATCATTGTTGATGATACCTCAGTTTTAGGAAGTGTTGGAGCATGTTTTAAAATTATGTTGGGAGGAGGCATCATGGAGGTTGTTGAATAGTTTTTAT
TCACTTTATTTTAGCTTTATTTGGAGACGGCGAGAGGTAATTTAGTTTCTACATTGTGTGCATGTATATATGGATTTAAGAGCGTCTGAATCAATATTAT
ATAATTATATACATATATATATTGGCTTAATGATTTGTTATGTATTACTGTTATCAATTTAGTAACGTGTTGTATCCTGAGATAGATTGAAACTTTCAAA
GAGTCTCTGTCGAAATTAACTCTATGAGAGGAAGTCGAGCATACCTAGATAATAAATCACCATAATTGTCGGCTGTCCAATAGATTCATTACATTTCTGA
TTCTGTAGACATGTATTTTAGTAACGAAGGGTTAAATGAAAATGCGAGCTGATTGATGGACCCGATGCTTTGAGGTGAGAGTTGGGGAATATCAGTTCCT
TCTCAGTTAAGTTCTTCTATGAGAAGCTTCTGGTTAGGGCTTAGGTAAGTTTTCTGCATGCATCAGTCTGGATTCCTAAGGTGCCGAGGAAGGTGTGCTT
CGTGTAGTTAGCTACTAGAGGGGTGATTTTGAGGGCAGAGAATCTTAGAAATGAAAGGTTGTATGCTTGAGCTGGTGTTTCCTTTGTAAGGAAGCGGATG
AGGATGTGGACCATATTCTGTAACATTGCAAATCAGCTACCAGGTTATGGGAGGATATGTTCGGATCGTTTGGTGTTTCTTGGGTAATGCCAAGTTCCGT
GAAGAAGTTGATATCCAGCTAGAAGAGGGGAGCTAGGAGAAGAAGACACAAGGCTTGAAATGTTACTCTACTTGCTTTGATGTGGGAAGGAGAGAAATCA
GAGAGCTTTTGAAGTGGTGGAGATGAGCTCTACTTATTTGAGGAGTAGTCGCTGATCCCTTATTTTCTTTTGGTGCACTCATGTAATTCCTCTTTGTATA
GAGGGTTGGGTTTCTTTTGGAGAGAACCATATTTTGTAGGCTTCTCATTTTTTTGGTATACCTCTTTTATATGGACGAGTTGGCGTAGCTATTATTAATG
AAATCTTTTACCTGATTAAAAAAGTGTAATTGCATGAGCTTTTCATTAAAATCTTCTGTTTCAAGTAAAGTCTTGCCTGATCTGTGTACTTGACCGGTCA
CTTTTATACTTTGCTTCATTGATGACCATGTCATGTTGGTTTCAGCCAAGGTCCTTTTCCGGGAAAAGCAGATGCAAAGCAGGCAGAAGGGATGATAGAA
GTAGAGTTAGGCTCAGAAAAACACAAGGAAGAAGAAAGCCAAAAAATAAAGCGAGACAAAATGACGAACACACCCAAGTCAAGCAGCAAAAAATCTGTGA
GTGTGCATCTTCTGTTCTCTTTGATTTAATTATGTCCTGTTTTCTGAAGTTAATTGATCGATGTAAAATGAATGTCTCAAGTGGAGAACAATCTAGCTGT
TAAAGAAACCTGGCAGACTCAGAAGAACTTAAGAGTGTAGTGTAGACGAAAAAAGCTCCCAACTTTTATGAGCAGACAAGTTCTGTTGCATGAATTTCTT
ATTTGAATCATGTGTGTGGTGTGTCCAAATATTTTCGCCTTAGATATGAAGTTGAGAATCTTATTTTTCTTATAGGATTCTGGACCTTCGTCGAGCAAAT
CA