Description :
From Genome Similarity Track
Location :
Scaffold_120:10344- 12025
Sequence
1681 bases(100 bases per row)
TTGGGTGGTGAAGATGGCCGAACGAGCAAAGTTGATCTCTGCGTTTATCACACCGTCGGGTAAGTTTGAATGGTTGAGGATGCCTTTTGGACTGAAGAAC
GCTCCACAGATTTACCAGCGCTTGATTGATACCACTTTGTATGGATATCTCAAGATAGGCGCGGGTAAAGATGCGATTGCAACGGATCCCCCTAAGTTGA
GTGATGTGTTCACTGAGGGACAACCCAAAACCGACAGGACGCCGACAGTGCTGGGCAGACGATCTTATATTGATCCCAGTTACATCGTGGACTTTTCTGT
CTAACAAGGTAGAGCGATTACGGACAGTATTCGATCGATGGAATTTGTAGGTCCGCCTGACTAAGCGTTTCTGGGGACGGTGTAAGGTGTATTACTTGGA
TCACCAGGTATCATTGGATAGGTTGGAAGCTAGTCCTAAGGATCTAGGATCGCTGGTGAATGTACTCTTCCCCACGACGTTGCGCGCCATGCATTCGTTC
CTGGGTAGTTTAAATTACTCCAGCCGCTTCATGGTGGATTTTTTTGCAGTATACGCACCTGTTTTATGCCAGCTACGAGAGACAGATTTTTACGAGATTT
ACTGTATGGGTGATCGTGATACGATAGTAGGAGATCTCTATCGTACTCCAATTAAGGTAAGGGATCACGAGCTCACCCTCCGAGAAGATGATCGCGACCT
GAATGGGCGAACTTGGTGGGAAGAAGCTAAAATCGCATTAGCTATACTGAGAGCCAAGATCTCAACTACTCCGACCCTCAGGTACTTTGACCCAGATCGA
CTCCCGGTGATCGTGGTATATGCTATCAGGAGCAGTGTCTGCATCCTGCTGCAGGATATGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN