Description :
From Genome Similarity Track
Location :
Scaffold_10:103433- 104889
Transcript NameFunction/comments
Albla_Nc14014400nucleolar protein Nop56 putative

Sequence
1456 bases(100 bases per row)
GACATCTGCTTCTACCTTCTCCTTCTCTTTTCCTTTCTGCTTCTTGTTCTTCTTCTTCTTTTTCGATGGCTTCTCCTCGCTTGCATCATCTTCATTGGTA
TGAGATCGCTTTTTGCTTTTACTCACCTCAGCTGAACCATTCACTCGCTCAGTCTTCAATTCGGCTGAAACCTTGGCCATGACGTCAGCATTCTTTCGAG
GGGCAGCTCCACTTTCGTAGAAGGCAAGACGTTCTTCAACCTGCTCACGCATCTGTTCACCAAACTTGGTTGTAGGCTCATCAATAAAGGAGTCAATTCG
GGATGCAATTGCACATTTGTTGGCTAGATAGCGAGATATTCTTCCCTTATTTTTTGCTGCAGCTCGTCCGATAAAAGTCGAATGGAAGAGAAGACCGTAC
TTAGGGGTATTGCCTCGAGTTTTCAGGGCACGAAACAAAGCCTTTTCAGCGCCAAGTATTTGTACAGTGGAGGCGGGACACTTTGCCAGGTTTGTAAGAG
AGCCCGCATGGGAAATGAGTCGAGCGCCAACTGTTTCGCCAATGAGACTAGCAAGATTAGGAGCCACGGTAGACATTTTACTGATGAGATAGTCGTGCAA
TTGACGACGATACTCAGCCAGCTTGACCAGTCGAGTTGCAAAACTGTCGACGTTAATCATGTCAATTTCAGACATATCCATCCCCATAGATATACGTGAA
GCCTGTACAATTTGCTTTGCCTTTTCTTCATCCAAGACGATTTTAATCAACCCTTGCATCGTCTCATCGCCTTCTTCCGCAGACGATAATGTGCTACGGT
TCTTGATAAATGATGCACAGCGAGCATAATTATAATTATCATTGACAATTTTCACAAGTTCGGGAAAGTGCCAAGAGTACCATTCCCGAATTCGCATTGC
AAAAGTGTTGATATCTTTGTCCATTTGATCCAAAAGTGCTATACTTTGGATGATCATGTTATCAGCACGATTCACGTTGAATTTAACCTTGGCACGAGAA
TAGCTATGTCCCAAACCAAGCTGGGCTTTGCTCAGATTTCCATGATCCAAGCCCTTAACCATTTTACTGAAATGATAACGGATTCCACGAACAATTTCGT
GCGTAGTTTCATTCGAAGTGCAGGACACACTGAGTTCATCCGACACAGATTGTGCTAGATTTTTGTCTTGAATGCCTAATGAGAACTTTGCTTTCTTGGA
TTTTCCTTTCGCTGGCAAATTCATTTCCAAAAAGTTTTTCAGATCCTCGCACATCAGACCTTCCGATATCGAGTTTATGTTTTCCAGCGCATTTTCACCA
GACTTGAATGGTTGGAATGCTTTCAGCTTCATTAGTCGACCAAAGCTTGCCACATCCGTCACACTTTCTTGCACTTCGTTTAGCAGCACACCAACTTCTT
CATGCTCGATGACTTGGAACAAAGCATAGCCTGACGCTGACTCAAACAATACAAGC