Description :
From Genome Similarity Track
Location :
Scaffold_1:103429- 105073
Sequence
1644 bases(100 bases per row)
GTCGTGGACGACGTGGTCCTAGAGGACACCAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCTTCAAAGATTCTTTGGATCCCTTCTACCCGGTGG
TGAAGGAGTATGGAGACGTTGTCTCGAATGACCCACCGACGGGCCTGCCTCCAGATCGAGGCGTGTGTCATGAAATTGACCTGGTTCCTGGAACCAAATA
CTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCATGAGGCAGGGATGGTGCGTGAGAGTAAG
TCTCCGCACTCGACACCCACGTTCTGTGGCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGC
AAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGTTGTACAGTGGGCTCGACTTGGTCGATGGTTACTACCAATTGCTCAT
GAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGTGAGTGGCTGGTCATGCCCCACGGGCTGTCGAGCGCACCAGAAACG
TTCAATCGTCTTGTGACGCAGTTGTTTAGGCCCCACCGGGCGTACGCTCAGACGTACTTTGACGGTATATTCGTCCATAGTCGTGCCGAGCACGGAAAGT
CAGACGTGGTTAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCACACTAATAAATTGTATGTCAACTTGGACAAGTGCGTCTTTGGCGCGGA
GGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTAAGGGCAGATCCTGCCGAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAA
AAAAGACTTGCGCAAGTGGCTAGGCTTAGCCAATTACTTGCATGAGTACAGCGCGAACTACGCGGAGATAGCTCGGCCATTATCAGATCTCCTTACGAAG
GACGCACCATGGTGCTGGAACGTCGAGCTCGACAGAGCCTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGACTCCGATCCTTGCGCTACCGGACCCGGATA
TTCCGTTTAGCATCGTCTATGACGCCTCTGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGACGGGCGTGAACGCGTGATTGCGTTTGAGTC
TGGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGACGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGC
TCTAAGCCCTTTGTGATCTTTACTGATCATGCGTCGCTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCATTG
CCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGACGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAATTAGCTCATGTCACGAC
AGTGACGTCGTCAGTGCCTGACTTGATACGCAGAGCGTATGCACAGGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTAAAGAC
TCTTACAAAGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCG