Description :
From Genome Similarity Track
Location :
Scaffold_481:10341- 12474
Sequence
2133 bases(100 bases per row)
AGCATCCGGTGCCTTCGACAACAACTTCGCGACGCTGAAGAGACGATCCGACTCCAAGCGCGCGAGATCGATATGCTAACGACCTCGCTGCGCCGGAGTC
TTCGAATTTGATTCGGACACGAAGGACGAAGAAATCTTGGGCTTTCCATCGTCGCGCCGACCAAGGACACCGGAATTCGTCGACAACTTCAATTCCACCA
CGCGAAGTCCAAACCTTGCAGGAAACTATAGCCAGTTACGGTCGTATCCTCGCCGGCAACGCCCCGTGTTAGTGAAGGTCGAAGTAGTTCATGGCAGTTA
CTAACGTCACACAGCAGCAACGTCCCCATGACTCAACTCGCTACGACTGTGCCCTCGCCATCACCGCCAAGTGTGAGTGAAGATGGCTGCACACCGAGTC
TGACTAGCCAACCTGCGATAGCTTCATCATCCAGCGAAAGCGAGGACGTTGTCAGCGAGTCTGGGATCGTGCACAACCAAAACCCAATAGAGTTCTATTA
TTACGCCATCAAAGCAACAGCTTTTATGCACCTTCGCGCTGGTACTGGCCATGTATTAACCGGGACGTTGCCAAAACTTCTAACGCAATGCGCCATGGAC
TTTGGCTCTGAAATCATATGTCACTATGCAAGTGGCCCGGCCGGGGCAGAGATATTCCAAGCCGCAATGAACCTTTGTGCTCATGAGAACCACTTCCCGA
AGCACCGAGGAAAATCGAAACGAGCAATCCTTTGCATCGGCGTGTACTACTTCAACGCTGATTACTACGTGGTTCAAGTTGACAACGTGCACAGTCTTAA
CGTCGATACAGCACGAACAATGCTGAATAAGCGTTCTCTCGGCGGAATTATGAGAGCACACGAGAAGATCGAAAACGTTCAGCTTCGATATCTGTCTCTC
CACCGCGTGACAATTGTCGAGCGAGTGTCGTTTGAGCACAACTGGGATTCTGCTTCTTGGTGTCTGGATGAAATCAAGACAATTCGCCAAAAGTTCAAAT
GCGACTGCAAGTCGTTTTACCAATCTGGATGGCTGTGCGCACACGTACTAGCTTGTTTACAGCTAGTGGACGCAGTGGAGTTGAGCGCAATTCTCCGGTA
TTTGCCAGCTCGTAGACCGCCTGGGCGTCCTCGAAAGAAAACTAAGTGCCTAAAAAGCGACGGTCTCAGGAGGTCACAATATAGTGTGACCGCACTGATC
AAGAGATTAGTCGATAAGCCCGCGAGTGTTACCAACTGGAGTGTTCTGGGAACCTGGACCAACACAGGTGACGATGGTGTTAAAATCAGCCGGGACTTCT
TCGGAACAATCAAGCCACCGTTTTCGAGCGCTGGTAAACAGCATTGGAATGTGAATTTTCTCGAAATTGAGAAAGAGGAGGACTATGAGGCTGAAGAGCT
TGCCACTATGATCAACTACTCGTTTCGGATGGGGCACATCATTGTTCGAAGCTAATCGGTAAGTAGTGTGTGCACTACCGCGTCTACATTTGTATGCCTG
CATTTTAATCAAAGCAAGAAACTCAGAAAAAGAAGATAAAACAGAAATTACTTTAAAAAAAAGGAGTGGTTCCACCCACCTCTCCAAAAAATCTTGTGTT
AAAATCTGACATAGAATTTAGCCGGTGGCATACAATAACACCGGTGGAATACAATATCACCCTCCGCATGGAAAATAGCTGGCGGGGAATAAAAAGAAAC
CGAAAATGCACGCAATAAAAAATAGCCGATGAAAGCATGAAAAAAAAAACGCCCCCCTCATTATTGGGCGGTGCCCTGGACAGCAGGAGGGTTCTTGACA
TCGTATTGCCAGGGCCACTCTCGGTAAGAAAAAGCTCTTCATTGAGTCCGACAGCCACTGTATTTTCCTAATACTGTAGAGAAGTTTAGTTCATATTTTG
AGCACGTTGACGGCGTGTACGCTATCGAGGATATTGAGCAGTAGAGTGCCCAATAATTGGTACAATATATTGCATTGGCTTCTTTAAATACTCTTAATTA
TTTCAGTTATTGAGGTGTGGTTAACATGACAGGATGGGTGGTTGCACATAATTATTGCACCAGTTTTTGTGGTAGGGTTAATACCTTTATACCAAGGCCA
TCACGCAAGTGTAGAAAAGTCGGGTTTGCAAGT