Description :
From Genome Similarity Track
Location :
scaffold_11:103407- 104409
Transcript NameFunction/comments
Plaha_PHALS_10667hypothetical protein

Sequence
1002 bases(100 bases per row)
CGTTTGCCAGCTATGAGTTTGCGATGACGACACACCTCTTATGACGCTATAATCGGGTGTCAGTGGGATGATTAAAAAAACTTACCTTCATGCTATTGAT
GATGGGACTCACAACCTGGTAGAGCAAGGAAAATATAGATATCTCTTGCTGGATGAGAGGAGCTAAGATGGACATGAATTCGTTTATACTCCAGACGAAG
CGATATCGCGTGGTGTAATCGGATCTCGAGCTAGCAGGACGCGTGAAAAGTTGTGCTGCAGCACCCAACGCATTATAAAAAAACGGCATTCTTGACTTGC
GAAGGTTCAGGTTACAAATGTTGTGGGTGGTCGCACCGCTTNNNNNNNNNNAATTGCGTGGGCTCTATTATGTCATTATCGCTTAAAGTGCTTCAAAGCA
GGATTCAATAATCGAACAATATCTATTTTAGTCGTCCATACTGCTTATAGAGTCGGTAAAGCAAGGAGTCATTTCGTGGATTTTTTGTGGTATACACAAA
ACTGGACGCTGGGCCGTCTGTCAAGCCTTTCACTGCGGTTTCGCCAACGGCGCGTTACGGCGGACCGACAGTATCACGGACCGATACGCAGACTCGAACG
TCGTTTGTGCCATTTTACACTTTACCACGCACGACACACGTAAGTAAGTCTCGATTTTAATGGGCAATAAGCTCGTCGCAGGACACGAACGCATGTCTCT
CGCCAGTCGAGTCGCAAAATCCAAGCGCCAGTCTCAGTCTCGAGTCAGTGTTCGTCACTTGACGTCACCTATGTCACCAACATTGCAACATGTCCAACAA
AAACATCGAAAACGTCGTTCTCGGTCGCAGAGTGAAGGTGTGACGAGTGATTGTAGTACGGCGATATCCACGAATGACTCGTTAGTGCCGCGCACGTCAA
ACGTCAGTGATAAAGTTCCACGACATTCATCACCATTAGATCCAACGACAGAAGAAGAGGAACATGTTGACAGTATGTCGACAAGTAATCGAAACGACAG
AG