Description :
From Genome Similarity Track
Location :
contig_46:103401- 105185
Transcript NameFunction/comments
g9583.t1hypothetical protein

Sequence
1784 bases(100 bases per row)
AGAACTGGGAGTCTTCAAGCCTGCGGCGGGGTCCGACCAACGTGGCATTTTACTCCGTCGGGATCTCTCTGCGCCCCGCAGCATCGCGTGCTTCGCCACC
AAGCCAGAAACGAAGAGCTCTTCAAATAGGTGCGTAAAACGCCTTGGTGCTCGCTCATTATTCAGGTTTCACCAGGCGCCCTGCACTCCAAAATTACATA
TGTGTCGGCCAGCCAAGGCGATTCAGCTCGAAATTCGCCGTTCGTTTCGCCATTGGAGAGAGCTCTCCTCTTGTCACAAGGAACACGACTGGACAAGTAA
AAGTGCGATGGTGGAAGCGTCCTCGCAGCTTCTCAGAGAAGGTTCTGCCCCCGCGAGCAACGCGAAGTGAGCGTTGAGGCAGCAAACACGTCGCACCCCT
GCAGTGAGAGACATCCTTTTGCCTTGAGGCAAGCCATCTAGTTGAATACTGAAGCATGTCAGTCAGTGCTCATGTGGCGGCAAGTTGAGTCCGAATCCCC
CACCATAGAATTTCTTACCGCTGCAAATCAATTCGAGAGTGCCATTATAACGCTGCTATCCAGCATCTTGGCAGCCAATACACTCGGTAATCCTACGACA
GGCCGCAGGTCAACGTTGTCAACGCCGTCGTCCTGCAAATTGTCGCCACGACCAAGAAGAATATCAAAGTAAAACAGCGCACCCAGCCACTACCTGACGA
AGTTGAAGTTCTCTTGAGCTCGTTCTGCCTTTTCCTCCAATCAGATCATCTTATCCAGGAATAAAAACGCACCTTCCTCGATACAAAACCAACAAAAAGC
CCCGCCCCGCCCCCTCCGCCCCCATGAGCGAGCGCGCGGCCGACGGCGCCTCCAAGCCGCCCAAAGAGCCCGCGGCCCAGCTCAGCGTGGACGACGAGAT
CGCGACCGTCATGACCACGGCGTCCACCACCAAGAAGAAGGAGGACATGCGCAACGATAGCACGGGCATCACCGTGGGGGACTCGGCCCACACGCTGTCG
GACGTGCGTGCTGACGGCTTAAAAAATCGTCGCAGAAGAAGAACGAGGAGAACTGACTGTTTTTTTTAATTTTATTTTACGATCTTTTCTTTCAGGGCAA
AACGATCCACTACTCTGCAGAGCGGATCATCGGCAATGGCTCGTTCGGCGTCGTGTTCCAAGCTCAGTGGAAGAGACGGGCGAGATCGTCGCCATCAAGA
AGGTGCTGCAAGACAAACGCTTCAAGGTGGGGGAATGTTTTGTTTTAAATGTGTTCTTATTCTTCTACTGACGTTTATTTTAATTTATTATTGCTGTTGT
TGTAAGAATCGGGAGCTGCAGATCATGCGCCAGCTGCACCACGTGAACATTGTGCAGCTCAAACACTGCTTCTACTGCAACGGAGAGAAACCAGACGAAC
TGTATCTGAACTTGGTGCTCGAGTACATCCCCGACACGGTCTACGGCGTCGCCAGGCAGCTTCAGAAGGCCAAGCAGTACATGCCCGTGGTACTGGTCAA
GCTCTACATCTACCAGATTTGTCGCTCGCTGGCGTACATCCACTCCACGGGCATCTGCCATCGCGACATTAAGCCGCAGAACCTGCTGCTGGATCCCAGG
TCTCACGTGGTAAAGCTGTGCGATTTTGGAAGTGCCAAGGTGCTGCAGAAGAATGAGCCCAATGTGTCGTACATTTGCTCGCGCTACTACCGAGCCCCAG
AGCTCATTTTCGGCGCCACGGATTACACCACAGCTATCGGTAATTATTGCAGTTCTGTAGCTTAAAAGTGGTTCGTGTGCTGAC