Description :
From Genome Similarity Track
Location :
Scaffold_7:1033855- 1062137
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05365aspartyl protease family A01B
Phypa_INRA-310PPTG_05366hypothetical protein
Phypa_INRA-310PPTG_05367hypothetical protein
Phypa_INRA-310PPTG_05368hypothetical protein
Phypa_INRA-310PPTG_05369hypothetical protein
Phypa_INRA-310PPTG_05370nucleolin
Phypa_INRA-310PPTG_05371hypothetical protein

Sequence
28282 bases(100 bases per row)
ATCTTTATCCGGATTGCCGGATATTAGTCCGATCTTATCGGTCTGATTGGCTATAAATAAACGCTATCTGCTGCAATGCATTCTCACTCGGAGATTGAAC
ATGACAGTGATGAGGCCTCGTTGCGCGGCGCGTGGTGCTCGATACCGAGCATTTCTCGCTGTTCTTGCTCCTGTAATATATTTCCAAGCGTCTGACGCAG
TGGGCAGCGAGAAGAGCTTTCTGAAAATCCAGCTTCACAAGCAGCGGCAGCCGAGTTCCGAGTTGTCCCACAGATTGGCACACCAGCAAGCTCGAGCTCA
CAGACGAGCGCAGGAGGAGGTTACCAGTGGCGAAGGGAACTCTACACAGGGGACGCTGGCATTGAGTGAAGCCCCGTTGGGTGTGGGCTACGGGTACGTG
TATTATGCAATGATGTAATGTTTTTATTTGGAAGTTGATGGTTATGGTGCTTATGCTTTGCAGCACACACTACGCTGAGATCCACTTGGGGATCCCTGCG
CAACGTGCGTCGGTGATCGTAGACACTGGCAGCCACTTGACGGCTTTACCGTGTAGCACGTGTAATGGCTGTGGAACACATACCGACCCCCTCTTTGACG
TGTCCAAGTCCACAACAGCAAAATATTTAGGTTGCCATGATTTCGACTCATGCCGTTCGTGTGAAAACGATCGCTGCATGATCTCTCAGGTATCGATACT
GTGTACTTGCAGTTTTGGCATTGTTTTTGATATGTATCCAATGTTCCATTGTTCAGAGCTACATGGAAGGCAGCATGTGGCAAGCTGTAATGATAGACGA
GCTGGTGTGGGTGGGAGGCTTCTCCACTCCAAGTGACGAGATGGAGGGGATTCTGAAGACGTTTGGCTTTCGCTTTCCGGTGGGCTGTCAGACTAAGGAG
ACTGGTCTCTTCATTACGCAGAAGGAGAATGGCATCATGGGTCTTGGCCGCCATCGCTCCACTGTCATGTCTTATATGCTGAATGCAGGACGTGTGACGC
AGAATCTCTTCACCTTATGCTTTGCGGGGGATGGGGGCGAACTTGTGTTTGGAGGAGTCGACTACAGTCACCACACGAGTGATGTAGGCTACACACCGCT
GATCAACGACAATTCCGCCTATTATCCAGTCCACGTAAAGGACATTCGGATGAATGGTGTGTCGCTGGGTATTGATGCTGGTACGATCAATTCAGGCAGA
GGCGTGATTGTCGATAGCGGAACAACGGATACATTCTTTGACTCCAAAGGAAGCCGCACTTTTATGAAAGCGTTCCGGAATGCAGCAGGACGGGAGTACA
GTGAAAAGCGCATGGATCTTACTGCCGATGAGCTAGCAGCTCTCCCGACAATTTCTATTATCCTGTCTGGAATGAAAGGAGACGGCACTGACGACGTTCA
GCTGGATATTCCTGCATCGAGTTACCTTACCCCGTCCGATAACGCTGAATCATACTACGGCAACTTTCACTTCTCGGAGCGTAGCGGTGGAGGTAAGCTT
CGTCAACATTTATTTGTTTCGCTTTTTTCTTCAGATCCTGACATTTTATTTCTCGAATAGTTTTGGGAGCAAGTACCATGATCGGCTTTGATGTGATTTT
CGATACCGAAAACAAGCGCGTGGGCTTCGCTGAGTCTGATTGCGGTGCGTTGTTACTACGTACTTCCACGTATAAAGAGACAAGTTTTTCCTGACATTTT
GTGTTCGATCTTACAGGGAAAAGCTACGACAATACTAGCACTCCAAGACCAATCGCTTCAAATAGTACCGAACAACCAACCATCCAGACTGAGACGCCAG
TTGCTTCAAATGCGACGAACCAAACAGCCCCAACTGAAGCACAGATCACTGAGCAGCCGGTGTCTACTAATGCTACCTCCACAAGCTCGAGTAGTAATTC
GTCGGTGGAGTCAAACACAACGGCAACAGCGTTGGCGGATGCAGCAAATAATGTCGATGTAGTTACTGGTTCATCTACTGGGGCCACAACGAGTCGAGCA
AGCCCCAAGTTTGGCGCCTTTATCGCCGAAGTTATCCTCATTTCGCTGGTGGGTGTGGCACTTGCTGTAATGGTCTGGACCAAGTGGCGCACGCGATCTT
GGTCTCGTATCCCAGACGCAACTGAGACTTCGCGAGCACACATGGAGACGGTCGTGGATATAGACGACAGTCGAAGTTTGTCACCAACCACTCCGCCAGG
AAGTCCGTTATCTCCTCGGTCTCGAGCAGCTAGGAAAGGCCCGTCACCGAAGTTTACGATTGGCTCGCCCGTAGATGAAGATGCAGACGAGTTCCGCGAA
GAAGATGAAGATGCTAGTAGTTTCCCGATCACCGGTCGTTCACAAGGCCCACGTACCAATCTGTAGACGAAATCTATATATAAACGCCAAATTCTGTCTA
TATATTAACTTCAACAAAAAGCATATACTTCCTAATGTTCAGCTCAGAATTTGGCGTTAATTTGGCACGCATCAGAGTTTGCCCTCGTTTCAGTGACATA
TCACCTTCCAAATTTGGAAGTTCCAAACAACTGCACATTCGATGCAGGTGAACGACGCTGTTGAGCGCCGCGTGTTCCTGGATGCGGCTGCCGGTGGTGA
TCTGGATGGAGTGAACGCATGGATCTCCGCGAGAAGAGACGTAAACGTGACGCTGGGTGAGGGCTGGACGGCGTTGCTCTACGCGGTGGCACACAGTCGC
ATGCGTATCGTGCAGAGACTTCTGAAGGAGGAAACCATTGACTTGAACGCCACCACAATGTAACCTATCAAGGTTAAACTTGACGACATAGGCAAACTAA
CGTAACTGCGGTGTTCTTGGCGTTTAGAACAGGATCGTCGGCGTTGACACTGGCGCTCACACGCAAAAACAACTCGCTGGTAGCTTTGCTGTTACGCAGT
GGAGCTTCTCGCGCTACGATACGTAAGTAACCCTTGCTAGAGGACGCTATTTGATAGCCCCGCTTGTGTTGACGTTCAGATCTTCGCAGCAATTGCGATG
TGGCAGGAATTGGCTGCATCAACTTGGGTTCGCGATGAAGTTAGGCACATGCTATCGCCAGATTGGGCTGTCGTGTGGAATCCGACATTGCATCGGCATT
TCCCACCGGCCGAGCGCGAGAAATGCCGCCTCATTGTGCACGCGAACGTGTTGGCGTTGCGGTTTCTGGAGAGTCCAGCCATGACATCATCGGCTTCATC
GGGGTGGAAGTTTGAAGCGATGCAGCAGTTTTGGTGGATAGCTGCTGCCTTGACAGGACCATTTAAGGCAGCAGAACAGCCCGTGCGGTGGCGATATCTG
GCGGAACCCTTGGTCTACCACATCATAGAGTTCGCTGTCTTCCTCTGGTGAAATGGCGTTGACGTGTTGTAAGATTTTGCTGCATGGACAGCACCGCACA
CTGAGCCGGGGATTCACCGCGAGTAAGTCGATCAATTCCCGGCCATGCTGCTTCACGTCGGTGATGATCCTTAATGCTTACGCTGGGCGCGTAGAGACTT
CAAGGCCGCCGACCTTCCTGTCCAGCAATTTGTTGGCAGCAAAGGAAGAGTGGCCCTTTACTTCGCGTTTCCAATCCTTCAGGATGGTACATCACGGATA
CCTCGTGCTGCCATCGCTGAGGTTCTTGAGTGTGTGAGGCAACGCATCCCGATGAAGATTCGAGCTGAAAATGCGAAAACATTGCAGCACCAGCACCAGC
ACAACATAGACTTGAGCCAACTAGGCTAGTGCAGTAATCCTTGGCAGTACAGTACTCGTTGCAGGTGGTCTGAGTCACTCAACTGAGTGCCACGCTTGCA
TGCATACACGTCTACGGTGGACGTTTGGAGTGCCCCTGCACTGGTGCCACCGAAAATGCCGCATACAGCTGAGTCAACACCATCGGTATTCGCTGCGGAC
TTCGATTCCTCGCCGCCGTTTGTTGGTTGGGTGGCCAGCAAGCCTTCTCCAGCGGAGAATCTCCCCAGCGTATCCTTGTATTTCCAAGCGTACAAAAGCA
AGAAAGAGCCAAGTCAATACTCTTGCCAAGTCATGAGTCAATGCCAGAATACAGATGCACCTGCCAATCCGCGGACATTTTGAATCAGAACATTCGAGTC
GAGCCAACATCGGCGACCGGTGTCAAGTTGAACGAATGCCATGGATATCATTTTATAGCCCTGCAGCCTCGCAGCGCGCTGTCTTGTGGCGGAAACCTCC
GGAGAGCAAGACAACATGCCTGGGTCGCGCATGGACGCATGAACTGGCTGTTCGTGTCGCACCGCCATATTTTGAGTTTTTTGATTTGCAGTTGAACATG
TGATTTTGCAGGTACAATGATTGTCATAAAACCTCAGTACCCTTACAAAAAATAAGATTGGTCCATTATACCTTATAGCACTACATAAAAAAGAGATAAA
TTCGATTAAGACGTTCCATCGGATAATACAGTTTTTTCTAAATCGCGCGGCGGGATAGGTTATGGCTCGCCCTCGTTTGCTTTGCAGCACATGCATGCAT
TCCTACAAATAACCGACACGCGCGCGTGGCCATTCTTACACCGAGCGAGCACGCACAGGTAAATGAACTGCATCGTATTCGAGCGCAGGCCGTGGGCGAG
GGAGCGTAAGGGGGGAGCGCAGGTGTCCTTGCCGGCTGCGTCCACTCTCCAAGTTGCCGAGATTCGCTGTTTGCTCCGCCGAAAAGATTCGAGCAGGTGT
TTTCACCTCGTTTCTGCATCGAATCTCGCACCAGTTGCCCCGCTCCGCCACGCTCTGCTGCAGAGGAAGAGTCTACTTTCTGAACTGCATTGGGACTGAT
TGGTTATCAGTTGTTTTTGTCTGCCACCTTCCTCAGACTGCGATTGAGACCGAGGAAGCGAAAACTCTACGTACTGTACCAACTTGACAGACAGCCATGA
AGTTCGGCAAGGTGTTGCAGCAGTCGACGCAGATGTCGCCCAGCGCATGGGAGCCCTACTGGTTCGACTACAAGCTGCTCAAGAAGATCATCAAAGACTG
CGCGCAGATCAAGAAGGAGGAGAAGCTTCAGGGTGACAAACTCGTCAAGATCAAGATCAAACCCTCCGCCAAGGAGGACAACGACAGCATCCGTACGTCG
TAATGATAGTTTTTGCAATTTTTGGACTCGTATTGACCTAGTTTGTGTCTAAATAGGTCAGTCGCAGGACGAAATGAACTTCTTTCGCACATTGCGCATG
GAGATCAAGAAGATCGCCGACTTCTTCATCAAGGAGCAGGCCAAACACACGAGTCAGGTAGCCGCCATCGACGCTAGCTTCCAGCAACTTAAGGTACGAC
GCTGTTGATGGAGGAAGATGTTGCTGAACGGTAATCCGAGGTACTAAGTGTCCTTTTTTACGTCGTGTATCGCTTAGACGAACCCCGAGTCGGCTGAAGC
CAAGACGGCGCTCATGAAGAGCTGCGTAGCGCTGTACAAGGAGCTTCTACTGCTCGAAAACTTCGCTGTCATGAATTTTTGCGGCATTTCAAAGGTATGA
ACCCACAATGTTGCATTATTGCCAAAACCTCTGGTCTAACTTTGAGTTTTGTCTTACAGATTTTGAAAAAGCACGACAAGTGGACGGGATATGCCACGCG
CAATAAATTCATGCACACGATCTTGATGAAGCAGCCTTTTGCGACGTATGAGCCTCTGCTGCAGATGATCGATCGTCTGGAGCATATCTTCATGCAGGCG
ACGGGATCGAGCATTGAACAGCACGACGCACAGAAGTCTTCGTCTCGACGCAGTGGAGGTGGTGGCAGCTCGTCATCTTCGCCTTCAGGAGACGCCCCCG
ACAGCTCAAAACCCGCCAATGGAGGTGCTGATGATAACGCTGCCTCTGGCAATGGATCGCCAAACCACTCGCCAAGTCACACACCACCTGGAGCTAGTGG
CGGTCGCCATGATGGACGCAGGTATAGAGGCGCGGTAGATGAATCGTCCCCAAGATCTGAAGATTCAGTGACGCTAGTGCGAGTGAACGCGCTTCGAGAT
GACGTCCGGGAACTTAGGAAGATCGAGAGCGCGTATGACGGCGACGGAGAATACGAGGATAACCCGGACGATGCCAGTTTCCCTGATGATGACTCTGAAG
TTCCACCGCTACGTTTTGGAGGCCGTCCACAAGAAGAAAAAGCTACGGGTCTCCTGCCCTCGCTGCCGCTGCGTGTTGCTCCTGCAGGCACCCAGTCAGA
CAGTGATGCTGCAGCGATTGCTATGCTTTCAATGAAAGACGCTGGCTTGAACGCGTCTGGACTTAGCAGCGATGGCGGTGACAGTGCGACGGATACCTGT
CGTACGCGGAGTGCTAAGCGTAAAGCGTGTGCACCACTAAACATGGAAGGCAAGCGCAAAATGAGCGTCACTGCGATTCTCAACTAGCAGCAACAGGATG
TCAAATTCGTCATAGCTGGAACAGAAGAGGGGGCGGGAATAACCTACGACACGTTGCATGTTGTTGCCATATTCATTCATCTTCCCTGGTCGCCTGTACT
CATTCGTTCTTGTGTTCTACCTCCAGCAAACCAAGGTTTCTCCCAAACTACTCCTACACACGTGTGAGCACTAGTCAGGCGGACAGAAAGCTCTAAATGC
TCCTTCGTCAAGCGTACTGCTGCCTTGCTCATCGTCTGAGTTGCAACACCTTCTGTCTCTTCCTAATGCCAGCGCCACAACAGCAAGTCGCCTAGTAGTA
GCGCCCAACTAAAAAGAAAATGATCGCGCACACCAGCAGATGTAGAGGACCAAATGCCTGTAGCAGCAAAACACAACAGTAAATAATCATCACTTTTGTT
GACAGCAATGACAACTAAACGTACCCCCTGATCCTTGGGACCTTTGCCCGTGATCGTCTGCGAGTCTTCGTTACCAGATACACCGTTGGCGCCGCCATTT
TTCCGATGACGAAGACCCGTCGACTCCTCCGGGATTTTCTTCACGCGCTGAGCGTCAGTGTTCGCCTTCTGCAGTAGCTGTCGGGTCTTGTCCAAGTCGC
TCATCAACACGTCACGCTGCGCAGTCAACTGCACTGTAAACGCCACCAACTACAACATACAAAGCCGTCAGCCGTCTACCCAATTGTCCTCACACTGTGT
GCCTCTTACCTCATCATATTTCTTGCGCAGGGCAGCAACCTCCTGGATATCTTTGCCTCCTTCTCTGTTCTCCGCGACCTTGGGCTTATCATCCTGCAGC
AATGCCGAGGACAGTTGTGCGGGTGTGGCCACTTCTTCTCGTGCTTCATCACTCTGTCTAGTCTGGAACCTCGATTCCGAGGCTGCTGCTGTCTTGGCTG
GCGATACGTTCGTTGACGACGCTCGCTGTGGACTGGGAGGCGAAGCTGGACGACCAGTATCCTCGCCGTCCTGCACAAAGCGACAGCGCAGCTTCTTGTT
GGATAACGCGCGCTTGTCCGTGCGTGCCCACATATTAGTGAGCTCATCTGCCATCTCTTTGGTGGATTTAGTCTTCACCAACTCGTAGAAACTGTCGTCC
ACGTAGATACTCTGTACCAAGAACTTATCGTTCGCCAATTGGCGCTCGGCCGGGTCCAGTCGCAGCAGCTCGTCGCAGTCCTTTTGCTGTAGGATCACCA
TGATGGAGGCTGAGCCATTGGGCCCCAGCAGACCCTGGTTGGGTCGCACCAGATAGCGCAGCGGCCGCGTCGTCTTGACCTTGAAGGCGATCTGCCGATC
ATCCGCCACGTTGCGGATTGTCAGCACCGCCTGGGGTGCCGTCTGAGGCTGCAGATGGAAGGACAGCGAGTCCGCCGGTTCCAGGATCACGCTCGAGTTG
GGCGCCAGCGCCACGTCCACGCCGCTGCTCGCCATCGCCACTTGACCGATCGATCGACGTTACGAGTCTGCGATGCGCAGATGTTGTCTGTTGTTCTCAG
TTCCCCCCTTAAGTGGTGTGTGGCACATATATTGGCACGACCAGAATTTTGTATGCGTACAATTCTGAAGATGAAAGGCAATTTTGGATTGGAACCTAAA
TGTAAGATGGACATGAAACGTTGCCCCAAGTGGTGGAGTAGAACCACTTTTACTTAGACCGTTTGGTCTTGCTCCGTGGCGGGCGTGTAGAGCCGCTGCA
GCTGACCAAGCTGCGCCTCGTAGTCTTCGTCGCTAAGTCGCGCCATAGTTTCGGCCACCGATTGGAACGTGTTCATAGCGCGCTCGTATTTCTGCGTCTG
CTGAGGCGTCTCAAACTTGGGCGGAGGCGGGTGGCCCAACATCGACTGGGACAGCTGGCTACGTCGCATCATTTTCAGCAGCACGTCCGGGTAAGCCTCA
TAGATCTCGCGGCTCACCGGGTGATTGTGCGTCACAACCTATACCAGACAAGCATCAATGTCAGAATAGATCAAAGATCATCAAATAGTCGTGGCGGAGC
TTACCTGGTCCGTGACGATCACCATGTACTTGGACGGATTATCAGCCGGGGTGATCTTGACATTGATCTTGGCCATGCAGCCAATGCCGCGGTACTTCTG
TCCGGGGCGAGTGTTAGCACCACGGCAACGCGCCTTCATGGCGTGTGTGCACATGTAAATCCGGTGGTGGTGGATGGCTTCGTCCGGGAACTCGGCGCGA
CGTCCACGCGAGCTCTTGTTGTTAAGCATGACCTTCTGCTGGTTACGACGGTAGGCTTCGACACTGCAGGATGAGCGCATGCGGAAGGGCTGGAACGTCT
CCTGCATGTACATTTCAAAGTACGAGTCGAAGTCGAACCACGAGTTGAACGAGACGCGCGCCATGCGCTTGCTATCAAATTTGACGTTAGCAGTCGCGTT
CGGGTCAGCGCCAACGCCAGCAGCAGCCGCAGCGGCTACCGCGTCCTGCACCGGGGTGGCCGAATCAGTCTTCAGCGGTTCAGGAGGTGGCACGACGGCC
GCAGCAGCCGCCGCCGCGTCGAACGCCACATCCACACCTACAGTCTCCTTCATCTTGGCCACGACATCGTGCATCTCGTCATCCTGAGTGGCCTGCGAGT
CCTGCGAGTTGGTGTCGTCTGCAGTAACAGCGTCCACAGTCGGCACAAGCGACGCGACGTCGTCATCGCGTTCACGGCGCTTCTCTCCCACCACCGGCTC
GTGATCCACCTTGCCGATGTCTTCCACCACCACTTGAGTCGTCGCAGCGTCCGCAGGTGTGTTTTCGTCGGCACCACTTGCAACCATAATTGACCGGATT
TGGCGCGTGGACGGATCGATTCGAAAGAAAGACTGCCACACCAGACTGGTGTGGCGCGATCCACAAATGCAACATAAAACCAAAATCCCCCTCTTCCGCA
AAAAAACCTCAAAACGCTGTGCACCACACATTTCGTGTGGCGTACAAGAAAGTTTCTGAGAAAAAAACTATCCCTCTCACAAGGAATAAACCTCGGAAAA
CTGGCTTCATGTGCACCACGTATTTTAAGTGCGGCACATTTCATTTCAGCAGGTCAGAGGTACACTGTACCATGTATCGCACAGCCAACCAAACAGCAGC
ACTGACGCTTGAAGGTATCAACGTGCTGGCAGCCAACGGTATTGACGCTGGTCATTTGGCAATCGCTCAGCAGCTCAAGACTCCGGTGATTCTACTCTAC
AGATACCATGGCCAAGAAGACGAAAGCTCCCGTTGCCGTGAAGCCTGCGTCCAGCAGCGACAGCTCGTCTGACTCCAGCAGTGACGAGGCGCCGCAGAAG
GTTGTGGTGGCCAAGAAGGGATCCAAGGCTGCCCCGAAGAAGCCCGTTGACTCGGACAGCTCGGATTCGGACTCGAGCTCCGACGAGGAGGAGGCTCCGA
AGAAGGTTGTGGCTAAGAAACCCGCTGCTAAGAAGGAGGAATCGAGCTCGGATTCGTCGGACTCGTCTTCGGATGAGGAGGAGGCGCCTAAGAAGGTCAC
GCCTTCAAAGAAGGTCGTTGCTAAGAAGGAGAGCTCTGACTCGAGCTCTGATTCGTCGTCGGACGAGGAGGAGGCTCCTAAGAAGGCTACCCCTACCAAA
AAGGTCGCTGCTAAGAAGGAAGAGAGCTCCGACTCCTCGGACTCGTCTTCGGATGAGGAGGAGGCTCCTAAGAAGGCAACACCCGCCAAGAAGGTCGCTG
CTAAGAAGGAAGACAGCGACAGCTCATCGTCAGACTCTAACTCGTCAGATGACGAGGAAACCGAGAAGCCCGTTGCTAAGAAGACTGCTGCTAAGAAGGA
GGAGTCTTCATCTTCTTCGTCGAGCGACTCGGACTCGTCTTCGGATGAGGAGGAGACTACTATTGTCTCCAAGAAGCGTAAGAACTCGGACGCCGGTGAG
AAGTCCAACAAGGTGCAGAAGCAGGAGAACGGTGATGCCGCTGCTGTGGCCAACCCGCAAAAGACCCTGGAGATCTTCATTGCAGGCCTGCCTTGGTCCG
CTACCGAGGACGAGGTCAAGGAGCACTTCGCTGGCTGCGGCGAGGTGACTGCTGCTCGCATTCCTCTGCAGAACGGCCGCTCTTCCGGTACCGCTTTCGT
GACCTTCGCCACCCCCGAGGCTGCTGAGGCAGCTCTTGCCATGGACGGACAGGACTTCGGTGGTCGTTGGATGAAGATCCGCACGGCTGAGAAAAAGAAC
ATGTTCGACGAGAAGCCGGACGGCTGCACCAGCATCTTCATTGGCAACCTTGCTTGGGATGTGGACGAGAACACGGTGCGTGAGACTTTCGCTGAGTGCG
GTGAGATCACCAGCTGCCGTCTGGCTACGGACCGCGAGACCGGTGAGTTCCGCGGCTTCGGACACGTTGACTTCGCCACGACGGAGGCTGTCGACGAGGC
TGTGAAGCTGGCTGGTTCGTACGTGAACGGCCGTGCCATTCGTGTGAACTACGCCAAGTCTCGCGACAATAACGGCGGCGGTGGTCGCGGTGGCTTCGGC
GGACGTGGCGGTGGTCGTGGCGGACGTGGTGGACGTGGTGGTTTCGACGGCGGCCGTGGCGGAGGCCGAGGCTTTGGTGGACGTGGAGGCGGCCGGGGTC
GCGGTGGAGGCCGTGGTGGACGTGGAGGACGTGGTGGCCGTGGCGACGGCCCGCCTAAGCGTCAGTCGTCGTCCATCCAGAACTTCCAGGGTTCCAAGGT
GACTTTCGACTAATTTAATGGGGACAACCTTCACGTAGGCCAAGGATACACTGTCGTGTATTGACTAGTTTTGCATTGCTTTGAGCTTCAATCGATTCTG
TTTACATAGACTCAAAAACGTTTTGTTAGTGGCATTCCAACTTTGAATTCTACAGGTACGGCGTCGGTGAGGGCAAACTTGGCGTTCTATCAAAAGTCGT
GAATTTTTTCAGTAATAATAACATTAAGCAAGAATCAACTTCAGAAGCAATATTCATGATGCTACATACATCAATCCAACATTATTAGTAGTAGTACGTA
CTTCTCTGGCCCGCTTCAAAATGACGCTTTCATATATTTACCGATAACTTTGAAGCCTAACCTCGGCAGAAAGCGGTAAGCACACCATTGAAAAGCCCCC
GGTTTAGCGCACCTGAGCATATTTTTTTGTTGCACTAGCAACAGGTACGGATGAGCACCATGCGCTCAAATTCCGCAGTTTGAATCCCATGAGGTTTTTT
GGCGCAGTTCAGTCAATATTTAGCGATATTACACCTAATTTTAAGGACGATTAAATTAGACGATTAGCTTCAATAGGATGTACCCATGCAGAAACGAATT
AGAAGCTCTAAAATTTGGACGCAAAGAGGGCGAGGATTATTTCCAAAATTTTGGGCATAACGGTGAGCCACCAATTAAAATTAACCAATCAGAAGATAGA
TAAGAATTAACCTAATATTTATGCTTTCCAAAACATGAAATTAGCTATTGAACTTAATTATGAATCGAAAAGCTGGCTGTACCCTTTTTTTCTTAACACT
ATTGCGGCAGAGGCCAACTTTCTCCATAGCCGCGCACACAGACCCACGGAGTAGGTGGCCGCGGACACTGCGCACAACACTACGCGAAGTCATATTGCAG
GTGGGATGTCCTTTTTTTCGGGGGTTCTTGGCATCGGCGTGAGTGGGATATTGGAGTTTGAGAGCGTTCACCAGTGTCAGAATTAGTGGTCGGGAGACAA
ATATAAGAACTTGTCACTTTTTATCCAATAAAAACAATTTACTCAGTTATGTGCGATTTATTAAAACCCCAATCGTCATTTTGAAGCGGGCCAGAGAAGT
ACTATCCATGATTCGCGGACACTGGAATTTCCCTGAAATATTACAATTTAGGCGAATTCATAATCTAATATAACTCTTCATAATTCTGACTGTGAAGATT
GATTATCTGTTTTGTAGCTTTTCATAATTCCGACTGTGATATTAAATACTCGGAGTATGTAAAAAGCGCTGGCTGCATCAATGCGTTAAAGTTCTAGACG
TAAAACTACAAAGTGAAGCTAGACCTGCCAAGATAAGGCGCTGGAAGATATAGACTTGTGTAGTGAGCAGAAAAAAAGAAATGATTGAGATGTTTAATTT
GTGGTCTTGATGTTTCACGGACACCACTAGTTTAGCTTTCCTGCTCAAATTGAAGCTATCAAGTTAACCACAGCCGAGAGGAGAACACAGCTTTTAATCT
TAGCGGTTGTCGGGCCATATGGGCCGCAACACTTGGGCAGGAAAAGAAGTAGAGGAGCTTGCAAAGAAAATGTGAAAGTGAGAGGTGATATTAAAGAGCT
TTGGAGAGAGAATAGCGGAGGCCATGGAGCCTGAACACGTAAACCAACCATCTCGAACAAGCGCAAAAACCGGAGTTCTAGATGCTAATTACATGTTCTA
GTTATTACACGGTTGACATTCCGTACAATCTGGCGTGAGGTTGCCACATCTACAGTGATGGTGTGTACTAGTGTGTGTGATATATCGTCAATTTGGACAC
ATCCTCCATAGCCTCTGTGTCGAGTTTGTCGAGCCATAGGGTTTGACTCGTACGCAGTTTCGGAAGAAGAGGAGAAGTTGTGAAGACAGAGCAAAAGAAA
GAGTGAGATTTAGAGTTAAGACGTAGATCGAGGGCACACGGAACGCGTGGCAGGTCTTGAGACCACCAAAGGTGAAGCTGCTTTCTGGTGAATCAGCGAT
GTGCGTGTCCTACGTAGAATCTGGTAACTAGTTGTCCCCAATGGTATCAACGCACTAACAGTTCCTGATATGTGAAAACGTCGGTGAGTGCAAGCTTGAA
TTCTCTTGAGTAACAGGCGAGAAACAAATGGTGTATTAATAAAAAAAATCCACTTTAAAAACAAAATTCATGATGCTACATAGCAATCCAATATTATTAC
ATGTATGACAACGCCACAACGTTTGTTGTGTTTGTTGAGGTGGCTCACGGATTTAACATGAGGCCGATGACCAGTTGCAGTGTCTTCGATGTACCTCACC
ACGACATCCTATCTAGAGACAGCGTGGAAACCATACAACGACACGTAGGGCGGTCCCAGATCGGAGACGTGCTGTTGAAGGCTCCAACTCCGTGCTTATC
CATTGGAGGGCACTGGATTCACCTGAATATTACAATTTAGACGAATCTTCAATCCAATGTAACTTTTCATTATTCCGACTGTGAAATTGATCACCTGTTC
TGTAACTTTTTCATAATTTCGACTGTGAAACAAAATACTTTTACGTTTCATTATACCAGCCACCAGTTAGTAGATGTGGACCACACAAACAGTTACATGT
TAATTAGCTAGAATAGAGACTTCATACTTGAACTCTAAAACTAAGGCTGTAAGACATAAATTACTATTCGACACCACTACACACACAGCACCTTGGAGTT
ATGCCAGGAACAATTGAAGCACGGAAGCTAAACACAGTTAGAAAGTCGTTGTGGCACTGACCTGATTGAGCTGGAAGCGCGTGGCGTATGATCTCAAAAA
GCTGTAAAAGCCATTTGAGCTGGGTAATGGAGCAGCAGGGTGTGTGTGTGTGGGGCTCCCGCAATAATGCAGGTGCCTAGGGCACTGAGCCTCCTCAAGA
CTGACCTAAGGGCGCCCCGGATTTTTAAACAATAACATTTAGAAATATTATAGAAATCCAGTACTGAAATAGTTAGTGTGGCAAACTTCCGCAGCAAAGT
CTGTGCCTTTATATATAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCCTCTCT
TCCAAAAGCAATACAAAACTTGCATAGCGCCTCTGACACATCTCCACTGAGTGTTGGCACAGGATGTATACCAAGTTCTATTTCGTAGGACGGAAGATAG
CGCTGACGAGGATCTGGCTGCTTGAGTTTGGCTTGTTTCAGCTTAAGTGGACGAGGCTTTGGCCGTAGTGTACGCGTTTTTCTTTTCTTCTTCTGTGGAG
ACATGGTGCTCGGCAAAGAAAACTCGAAATTAGAGGAGAATAGAAGAATGAACAGGGCGGGGCCGTTTTGAAACCGACGGGGTTCCGAGTACACGTAGTT
TGTATGGAAATTTGCTGGTCTTCAAATAGGCGTCCGCCAAAACTTAAATTAGGCATTGTGTATTTTCTCGCAACACAAATCCTAGATAGAAGAGGCCTGC
CAATGGTACGTGCACACTCAAGCCATATGCACAGTAAAAAAAGAAGCGAACGCTACTTAGGGTAAAAAAAGCTTATTTCTAGTTGGCTACTATTCTAACT
GCTAATTTCCTAGTAGGCCATGTTGTCAAAATAGACGAAACATGCTTAAAAAAAGGAAGAATACAATCATGGAACTCGCTACCCAGATTATGGGTGTTCC
GTAGTGTAGACCACACTACTAAAAGTGCTTTGCGAGGTACGTCTACAACGACCACACGAAATATACGTTGTCTGCGCTCATATCAATCCAGGGTAAGCTT
TGACACTCTGTGGGTACATGACTAGTGAAAATGACATTACGTGGCTATGTTAGGGCTTTCATCATCTCCGATATGTCAATGCGTACGTCATTCAATTTCA
GCGTGGTTGTAACAGGGGCAAATGATACACTTTATCTAGCTATCCACACTTGCGTGGCATGCGCTACCAACATCTATGGGTTAACCTTAGCAGGAACATC
AAGCATCGATCGACTGGTGCCCACATGAACCGTATTGAGGGCGTGTGGGAGGTAAAGACCAAGCAGCGTATTAAGGATGGACGGGGCACGAGGAAAACGG
TGGTGGCGCGATACCTTGGTGAATGCATGTGGCGTAAATGGCACTTTAGTGAAAACCCACCTAAGAGTCAATACTTCCAGGGTCTTATTACAGGTATCAT
GAAGTATAGTGAATGAGATGCAGTTCTTGTTCTGGTAATGCCGGATTTTTACTTAAATAGTTTCTATAATATTTCTAATATTTGTTTTAGAAATTCGGGC
GCCTATAGGTCAGTGCCAGCTCTTCGAAAACCAAGAGTGACAGAGAGAACAAGAGTGAGGTCGTGCGTTTGGTGAGAGGAGTGCTGTTTTGTGACCAGCA
AACACTCGAATTACTTACGAAGGCTACACATATGCCGAAGGCTACGTTATGACGCAATTGAAGAGTGGCTGGCTTTGCTGTGCGGCTCGCACGTGAAGAC
AACCCTAACGACGGTCGACAAGGATCGCCAACTTCGCTATTACCTAATGCATTTTGAGCGTCTGATAGATAAATTAGTTCAATAATTGTCTTGATATTGT
TTTAAGGTGTTTAACCTACAGAATGGCCCATATCTATAATATTACACACATCGACGAGAAGAAATTTAAAATGCATAAATGGGCCACGCGCACTATTTGG
CTCCTGATAAAGACCTACCATATTGTTCACCATCAAACATGCGGCACATAGGTACGGTTACGTTTTAGCTGCCATCGGGCGCCCAAGCTTCTGTGGAATA
ACAAAAAACGATTATGACGGAATAGGCATATGACCTATTGTCGAACATAGCGAGTTTAAAAATCTAGTTGCAGGAGGGTTGTTACAAAAACGTCAACATG
ACACGAAGAATTTACAAAAATAAATCGTGATACACCTCTTCCAATCCAAACTGGCGGTAGTGTAAGGCAAAGTGGGCTTCAATAATTAAAGTAACACTTA
AAAATAAAATATTGTTTTCAAAAATGAACTTAGATTAATGGGGATTTAGTGTTCCCAAACTGGTGGTTCAGAGCCAGAACCTCAATCTCAACTGCTCTCG
CATGCCAAGCGAGCCTAAGCACGGGCTTGCCACTCGGACGCGGGTGCTTGGCGCACTGAAGAGCGGTAGAGACTGGATGCTAGTCGCAGACTGCAATGAC
ATCGTGCTCACGGCATCCCGCAAGATCATTGACCGCGGGCCAACCGACGTCCAGACGAGAGGCAGCGCGCGTGCGGCATGTACGAAGTGCACGCCCGAGA
TAGAGGACGCCCTAGTGGCGTACCGCGAGAAAAATTGTCTGTTTACACTAAAGCAAGTGCAGAATATGCTGCGGTTTGGCTTTGGAGTTCGCGTAAGCAC
CTCCCTTACTAGTAAACAAACTGTGCAATAAGCTGAACACAGTCGAGAAGGTATAGTGATGTTTGTACTGAGATGAGATCATTTATATATATATGGCTTG
CTAGGCAGGTTCGTATTGAGCCAAAAACTTGAATTCATGACGCCAACATTGAGAAGCGACGAGTGTTCGGTGAAGCTCTGCTTGCGCATGAGAAGGAAGG
TTACTTTGTCGTTTCTTATGACGAAACGAAATACTATCTCTATTGTAAGCGCTCTCTATTTGGAAGCGAGAACTTGTAGCGCTTTCACCACGAACGTACA
ACTGCTGTGCGCGGTGTCGCCTGACGTCGGGCTGGTCCATTGGGCTAGACGCCGTGAAAGTATTAAAATGGAGGTAAATGCAGCGTTTCTAGACGACGTC
TACAACGCTGTCAAGAAGACCGACGTTTACAAGAGCCATTTTGTCGGGAACTACTAAAGACCCGTGACAGAAGTACTACACCTTTGTGCACTCAACTTCG
TAGTAAACAGAATTCAAACTCGTAACTTAAAATTTGGCAAACAGGAAAATTACGATAGGAGCGCATAATCAGTATTCAATATTATAGAAATCCANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTCGTATGGAGCTTCACTGTAGCAAGGCTGTCAACGCTGCTGCT
GAAGGAATAGCTATGGTCTACGGTAAATAGTCAACGAGGTCGATTGCAGTTTTTTCAACATTGAATGCTGATTATGCGCTCCTATCGTAATTTTCCTGTT
TGCCAAATTTTAAGTTACGAGTTTGAATTCTGTTTAGTACGAAGTTGATGCACAAAGGTGTAGAGCCCCGAGACAGTACCAAACATTTGGTACCGATTGT
ATGATACAGTCGGTTGCACCATCTTCTGCTGCATCAGTTCATGCCAACTATTATTAGAGCCCCAACACGATGGTTGCTTAAGACAGAATAGACGTTTATC
AACAATGCCGAGAACTTCTGTAAATTCCGCTCACAAGTAAAGTATTGTAAGATTTAAAGATTTTAACGTTTGAATTGGGTAGCTTGAAAATCTAGCTTGT
TTCAGATAACTAAAAACTCCAATGGGCAACCTCGAGGTTCTGAGTCGAGTTGTCCTCTTCTTGAAGTCGACTTGATTCTGCTGCTGTTAAAAATGACTGT
GTTGCATGGTTGCTGGTGGACACCCTAAATGTTGTAGCCGTTTCACGTTCAAAGTTAGAGAGTTCAAAGGCGGATGGATTTCGTCTAGTACCCGATTTCC
CGCATCCCTTTTTGTGAGCTGTCTTCTGTTTTTTACGTGCAGCCCGTCGTGTCTTGATTTTGGGCTCGAATACGACGGCTCTTGGTGGTGGTGGCTCGGA
AAATCGATCAATGTGCCAGTGGACATGAAAATCATTTTTTTTTTGAGAGGTTTGGAATCTAGAAGTAGGTGATGAAGGCGATGGACACACGGAAGACCAG
TTGAATGAGAAAAAATGTTCCTGCACGAGATAATTGGATTTTTTTCCCATGATTTCAACGCACCTAAGTAACGCGTGACTGTGAATTACGTTTACCACAT
CCACAAACAAAGGACCCCGTAACAACCTGCGAACTTTCATTTTTTCCTCCGAAAGTGCTTCTTTGTGCTCCTTAATAGACAATTTCCACCAGTTGTTCAT
CGCGCTGAAGGCATCGATAAAATTTCCTTTTTTCTTAAGCCACTTCTTTAATGCTGCGTGATAGCTCTCAACTCGTGACGTTGCATAGATATCAAAGTGA
ACATGGTAGTTTGTCCAGCAACGGACAAATCTCATTTTCCATAACGAAAGCCAAGTATTTTCCACATAAAGAGCTTCTGTGGACGATAACCGGTGCAATT
CTCTACGCAACACTTCGTATTCGGACGCTGTCCCAGCGCGAGTTAACTTCTTGAAAACGTCCATGTATTCTTTTAATTTATCGGAGTCGACTCGTCTCTT
CTTGGGGTTGATGATGTTTATGAGTTGTACCTTCTCCCGTATCCGTTGTAGCTTCAGTATTGTCTTCTTCACGTAAAAATGCAAAATTCTGAATTGCATG
TTTCTTCACGTCTGATATTATATGCCAAACGCATAAAATCACTGGAATATCTGGCATCACAACTTCAAGAGAATTCATTAGAGCCACATCACAATCGGAA
AGTACAACTTGGGGCAGATCAATTCCTTCTTCATCTAGAATCTGTTTCAGTTGTGCAAGGCTCCACAGATAATCCTGTTCAGTTTCTCCCACCATGAAAA
CTTGCGCAAAATGTATAGTCGTGTTCATCCCGGTGACACCAACCACATTTAGGAGCGGCATGTCAAACTCACGTCCCAAGTCACTGAATATCAAAGTACA
AAAGAAGTAACTGAGTGCCTCACAAACGAGACTGCTCCCAATATCTCTTCTCCTGTGCAGCCTAAAGGCGAAGCGTGTCAAATGGGAGGAGTATATTCCG
TCAGTCGAGAGATCAGGTGAAACTTATCAGGGAGATCTGGATGTCAGTGATCACATACCTCCGGTTCTAATTTACGAATCGCCAGTAGAAGCAAAAAGAT
TAATGAATTCTTCGCTAGACAACATGGATACGCATTGCTTGTTGCCGACACACAGCGAGATCGCAAAAAAGTGAAGTATCGCGTCGTTTTTGCATGCGAT
AGGCACGGAACTTACAAACCCAAGTTAAAAACTAGTGTCGAAGCGGAACATCGTGTTAACACAGCTACGAGGAAATGCGGATGCCCGTTTCGAATAAACC
TGCACCTAAACAAATCGTCCCTCAAGTGGCATGTGCACTACGATCTCTCTCTGGGTTGGCACAAAAGCTACGATGGGAGTGAGCTACAGCATAGCCATGA
AGTGTCTACAAATTCAGCTTCCCATCCTACACACCGTCAGTCTGATATGACACACACTGTTAAAGAATCGATCATAGAAGACGCGAAACTTGGAGTTAAA
CCGGCGGCTACTTTATCTCGAATTTTGAACATGAATCCGACTTCAGCCATCACAAGAAAGGACGTTAACAATGTCCGTCACACTGTACGCAGAAAAAGAG
AATCTGGACACGAAAAAATGGCTACTCTTTTTGAACTTCTCTCTCCTGACACCCATTTTTGCTCGCACAATGTTGACTCAGCTCGTCGAATTATACACCA
TTTTTTCGCTCTTCGAGAAGCTGTGGCGATATTCCAAGCCAACCCGGACATCATACTGATGTACTGTACGTATAAAACCAATGAGTTTGACATGCCGCTC
CTAAATGTGGTTGGTGTCACCGGGATGAACACGACTATACATTTTGCGCAAGTTCGAAGTTTGAACGAAGAGAAAACTTTGATTGGGGTCGCAGCGAAGC
GTCATCGCTGTCACCGTCATTAACTGCTATGAACGGTTATTATCAGTTATCTGTTCGTTTTTATAGCGGTGGACCACATTGATTTTTACCGGTGGACCAC
ATAAGACGCGCAGCGGTATCGTACTGTGAACAGTTGCCAACGCACCAAGCTGGGTATCGTTGAGGGCTACAAAGTGTGCAATGGTGACGGAGATTCAGAG
GAGCGGCTCGCGGGAGAAGCTGAAGCTTAGCCGCAATGACGTTGGTAAGATCATGCGGTTTGAGGACGACATCTTAACGGAGTCGCAGCGGCGAAAGCGG
CAGCATCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGCAACATTTGTAGTACTGTATTATGTATAGCAACATTCCTTACACAAATGTTT
CAAGACATTTATCAGTAAAATGTAGCGCGATTTGTTTGTTGTTATTATTAATAATAATCACATTTACTTTTTTCAACGCGTATTTATCCAGTTATGCTGT
ATTTACGCGGCAATATTACTCGACGTTGTTGCCCCTACGGAAAAAATTAGGATGAGCACATCCTAATCCGGTTGCCACTTCGAGACAAGATTCTGTGCAC
ATGGGATGAGTAATAAAACCTCCATGATATCGTATCCAATCAGACTTGAGATCTCCTAGAGCAAATGTATCGTACGATAAGATATTTACATCCTATTTTC
TTCTATACTTGCTAATAAGAGAGTAATTCAATTCTCAGGGGTAGCGAGTCCTGATCTGGTAACGATGCGACTCCGATTGCGCGGACATTTCTTTTTACGA
AGGGTGTGCTTTTTTCTTTCGCATTTGGTACGCGTAAAATTGTGATTTCAGGAAGCAGCCAATATGATATAGATTTTATGTGCTATGTAAACTTCAGCTT
GAATGGTATTCACATGTCAACTTTACCAAACATTTGTCTTATTATTCGCGAGCTGTAAAAATAGTAATTCAATGGTGCCCTCCAATGGCATTTCGAATGT
ATCGTGCACGTAATGTTACACGAAAAACAGGTGTATGGCACTTGGGATTTAAGACTACCTAATATATTTCAGAAAACAAGTGTATTGCGCTGAAACAAAA
TAGAATGTTTAATACTGGTACAGGGAGTGGCATCACGGCTCAATGACGATGTCGTACAGTCTGACCGTTACTTGAGGCTCAACACCTCGGAAGAAGCTGG
GTTGGGTGCAACTTTTGATTCGAATAATGCTGCCGTCAACTGGTAACGCTGCCTCCGAAATATCATCAGCTTGGAAAATTGTCGCGGTCAGTAAAATTGA
GTTGACAGAAGCTGCTCGGGCATCGTAGTCGTCCTTGAACAGCTTAATGTGAACAAATCAAAATCGACCACATTATGAGTGTGTTATCGTCTGCGTAAAG
AAAAATATAAGACCAACTTGCCCTGTACAGCTCGTCCAGCGTTTCGGGTGTTTCTGCGTCGATCAAATGAAGTTTCAGAATATTTGAGTTGCCATAGTTG
TGCCGAGAAATCCAAATAACCCGCATGCGAATGACGGCTCCAAGCGTGTTTGCTCCGCCACTATGCTTGATTTTGTCCCTGACCTCTACACAGGTATCAC
GTTAGAGGCATGGTGTAATTGCTCAGAGCCACATACCTGCAAGTGTTGTGAGGACTGGCTTTCGTTTCGGTAGGCTGCCTGATTTCAGTAGCTCGCGCAT
CTGTTGACACGCTGTAAGCGGCTTCGGTTGTGCATCTACACTGTCGACTTATCGTTGCAAAACAATTCACACCAAACAGAGCTGTAGTCAGGATATCCTT
GCAGTATATTAACCACAGTAGTGAAACTTTTACAATACCGATACCTTGTACACACTGTTTCTTCAAAGTATCGTGGACCACGGGGATTTCCGCGGTTTCC
CTCTCTCGCTTCGCCTTCCCCACCATCGCGCAAATTTACAAATGGCAGTCAAGATATTATGTAGGGTGAGATCGCAGGTTCCATTCTGTTAGCACGCCTA
AACAGAGACTACTGTGAGCATCCTTATTGTAGTCAGCTATTAAAGAATGTCCAGCCGTTGATCACTGGGTTATCGTAGTAACCGCACGATAATATGCCCA
TTATTCTACTTTTCCTATTTGTAATAGTTGAGAGCTGCTGTACTGTCTATTTCCAACTTAAATAGTCTAACTACACCACATCAGTACTGCCAAACTTTTA
CTTACGAGGTACTTAAGCATGGAAATAACGATATGAATGTTCAATCTGGTAGAATATTTTTATGTGACAGGACACTTTACCGAAAGTGTCCAGTAAGCTC
TCTTGAGGCAACGCGTTTCGTTGTGTTCCTATTGTTAACTATATGAAATTATTTGATTCGACGATCGTTACCAGGTCACGTTTGAAAATCTGTCTAATCC
ATCCTTGGTACAACCTCTCGAGTAAGCACCAACCTCTCGCGGAATAATAGTGAGTTCATGGCGACGGACAGGACACTTTCAACAATAATGTCCTGAAGAT
ATTTGGTGAAGTGTCGTGCTTCTATCTTATCAGTACGATTTTTAGAAGTCGTTGGACCCGATCTCTTTAACAAGTAAGCACTCATTGCAGATGAGCAGTG
GTATATCCCACGGACACCCATGAACTATTGGCATTAGTGTGCTAAAATTAAATAAAAGGACACTTCAACCAAAGTGTCCTGCGCATTTGTTGAAGTGTCG
TGTTCGATTTTAAGGAGCACATAAAAACCATTGGTTCATTCGCTATTCTTTATCTACTATCCTTTATCACTCACAGCCAACGCGCTTAAATGGTAGGCCT
GTCAACTAAGGTATAACATTCGATTGCACTCTCATTCTCGAACTTACCCTCTTCCTAGCACTTTATCAATGCAGCCAATCGAAACGCTGAGTAGCGACGG
TTTTGTGGTGTACCGTGGTGTACTTAGCAACGACGCTGCCAACGCTGCCCGTATCATCGCGCGCCGCTCCCACTTACCATGGACGAATGAAGATGATTCA
AGTCCCCGTTTGCGTCGCGTCAGTGCAAGGGTTCCGCCAATCCCGGGTTTTCTGCTATCAATCATTCTCGAGCGATACATTCATACATTTTTCCCCGGGA
TGGATCAGTCCAAACTTGAATGGTGTTACCTCAAGTCTTACGCCGATGCACCTGACCAGCCGACTCACCGAGACTTCGCGGTGTCGAGGTACACTATAGA
TCCGATGGATGTTGCAAGTCTCCCCAGCTCTCTACTCATTGCCACGCAAGATGATACCGTTGTCTACGGTTATGGCTGGAACCACCATGTTGCATTTCAG
TCCGATCAAGTTGTGATCCGTCTGAAAATGGAGACCTCCTTTTTATGCGTGGTGATTTTATTTACTCCCGCGCCGGTTATACTTGGAACAATCTCTGTAT
CCATACATTTCTTGGCGAGATCACTACCCGTCCCCATTTCCGCGGTCAGTTGGTCCCATGCTACGATGATAAACCCACTGTGAACGCCCACGACGGTACC
TGCTACGTTTTAGGTTGCCGGTTTGTAGGCAACACAGACCATGCGCTCAGAATGCATCTGCGTAGCTGCCACAACGTGTTCATTCAGAGTTTCAGTCGGT
GTGCTCGAAGCAACGATCCACGTATTGCAGCGGCCGAAGCCGAGATTATCAACTTGGCGGATGATTTCTGAGTAAAAGGTGTGCTGGCCAAGTTCGTGGC
ATCCTTGATTCGATGACCTCGAAAATGTGTCTTTCAAAGCGGGCATTCGAGGTTCCATCATGACCTAGCGCCCCCAAAACAGACCATTAAAAACATTGAA
TCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN