Description :
From Genome Similarity Track
Location :
Scaffold_90:10336- 14434
Sequence
4098 bases(100 bases per row)
ACGATCCCTCTGTAGGATCTTTCGCGGAGTTGCGTATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGGGCTCCCCTTCTCCGAGAGATTCG
ATCTCGGTAGTCGCCTCGTACGCCATATTCTGCCATTCTCTGTAACGACGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCA
ACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACTTGGTCCCTGAATTACGGT
AGGCACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTCAACCGATCTGGCAGTTCCCAGGTTTCTCCGGGCTCGATCCAGGTC
GTCTTATCCGCCCTTATGATCCTCATCTACGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCGGGGAAACAAAGTGTCCCATCCG
CCAGATCCAACCTCACTCCGGCTGGTACCATGAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAACATCGAACCAGTATACCAAA
CAACCTGCCAGCCTGATCTTGATCCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTCGC
ACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTT
GGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCACGGGACTCTCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATACATAGGAT
CCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACTTCACCCTTGGTAGGATCAAACCATCGATCATGTTGGCGTTTCTCTTAATAACCACGTGCCT
CTCCTCTGTGTAGATCCAGGGTTATAGAGACTTCGGATCTGGAAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATGTAGATC
ACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACC
GGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTT
GTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACACCCCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACA
CTTTCTCACAGACCAGATGTTTTCCAGCATCCCAGATTCAGTGTGCCTCCCGGAATCGCCACTGCGAACACCTGACCTGGGCTGTCCCGTCCATGAGATC
TCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGACCGCGAGTTGTCTCCGGCCTTCGCCGTTCGATCGTTGGATGCAGTGAGACAGACT
CGACGGTAATCCTCAGGGTCGGAGTCCGAACCGTCAGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGCGCATTAG
GCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACTTCTTCGAGCTCATC
CGCGTCTGGAAGACGTAACAGGGTCAGCCTGTTGGCCAGATCCACATCTCCCAACGTCTCGATGAAGTGATCCACGTGTTCCCGCAGTACCCTGGATCCC
CCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTATTCGATGTAGGTATTCTAGCGGGGAATTAACTCGATCTGCGGCGAGCATGGTAGTAT
TGTCGTGCCACCGACACTCTCAATCTCACAGTACTGGGTCTGGAAGCTGCGTCGGCAAATTCGGGCCACTTGTTCCTGGGTGGAATCTGCCCCAGCTGCC
GATACCAGTTTCCTGGCTGGCCCCCGCTAGCCAGATTCGCCAAAAGGGTCAAACACTTCTCAGCATCCCGACGCTTGATCTCTCATGAGGGCCGACTGAC
TTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGA
CGATCCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAAGTGGATGGGCCGTCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTC
CCTCCACGGACTCCATCTCCCACGTCTCGAGCTCCATGTTCGGGAGCACTGCACTGGTGGCACGGGCTTTTACATACCCCTGTTGCGGCGAGAAAACGAA
TCCTGGCAAATTGGAGAGTTTCCTCGCGAGGTGCCCCGAGGAAGGTTTCGAAAATAGCCCGGGGGGCTGTTGGGCCCCCCGGGCGAGACCCGGATTCCCG
GAGAGGGTATTACCTTGACCCCGAAACAGAAGAATATTCCCACGGGCTTCTGCCGGATTTGGGCTAGTTTCCGGGGGGGAGGGGTGTTTCAGAATCACCG
CGTAGGGCGTACTGGATCCCGAGCCTTCACGTTCACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAA
GTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGAATCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACCGGAT
CCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTC
TGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAAAAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACC
GGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCGGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGA
GATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTT
TCTCGTTTCTTTGACTAGCGGGGTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTT
GTTAGCGGATCTTGACTTGCGTCAAAATTCGCAGGGGTCCCCGAGGGGACCTGAGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGGATCCACC
TCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTATTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTT
CCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGTGAAATCCCGAGTCACCAAAAACTCCGGGCACGCGCACCATTGTGGTGTAGCGGGAT
CAGCAAAATCTGCGAGATTGCTGGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGCAGGGGGCCCCCCTATGATCCGTGCTCTGCTGAACTTTC
CTCACCTTGTGTACCCGTCAGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGA
TGGGGTGGAGCAGCAGTGGAAAACCTTCACTCTGCGTCCGTGGATGTTTCTGGATCCCAAGCGAATATTCGAGCTTATGGATCCAGGGCCTAGATCGTGG
ATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTCCCTTGCCTTTGCGTTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGCGTTGAGA