Description :
From Genome Similarity Track
Location :
Scaffold_68:103350- 106894
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_20988Hypothetical protein

Sequence
3544 bases(100 bases per row)
CTCCTTCTTGGACCCGAGCGTCCGGAACGTCGAGCCTCTCGGCTTGGACGACGCCGACGTCGGCGCCGATGGCACTATGCCACTAGGACCCGACGCACGG
AGCTTCTCGAGGTCTTTCTGGAGCTGCGCAATCGTCTTGTCTTTTTCCCGACACTAGAATACACACATTGTTGTACGATGGACGCGTGTCCACGGATGCG
TACAAGATCGTCTTGCTGGCGCAGCTTGAGCTGGTGCGTCGCCAGAAGCATCTCCTTCTCTTGCTTGAGCTTGTCGCACTCATCGCGTATCGTATGAAAC
ATTGTCTTCATGTCGTCGTTTTCCTTGCGGAGACGCGCATTGTCGTCGTAGATGCGGCCAATCATGCCGTCGGCGTCGGCCATGACCAGCTGCGCACTCG
ACTTGCTCCGCTGACGGTTGAGAAGTGCCGCAGTGGACGGCGCGGGTGCGACGACTTCCTCTTCGTCTTTCGTCTGCTCAACTTGGAGCCGCACGCGCAA
CGAGCGGAGCTGCGTCGACATGTTGACTTGATCGCGGTGCTCGGCCAGCTTGGTTTGAAAGTTCTTGCGCTCCAAGTGCATGCGCATCGCCGCTTGAATC
GTCGTCGCCGCGCGCTTGAGCCGGAGAAAGCGTTGCCTACGCGCATCATGAGTGCGCGCACTTGAAAACCATCAAAAAGTCTACCGGACGGCGAACCCCC
GGACGTGGCTTAGCACAACGAGGGCCTTGTGGCGGCGCTGCATGACGGCAAAGACGCGACGCGCCTTCACGCCGCGCCAGCGAGCCTGGAACGCCAGCAT
CCCGTTGTAGAGCGCATGGTACCGCTTCATCGCGAGCACACAGCGCACGACCGCCTACGCCCGTGTCTAAACGTGCGCGCTTCAAGTGCATACGAAGCGC
ACCTGGAGCTTGACGATCGCCGCACGTTGGCGCCGATAGTGCAATCGGGCGAGGAACATGCGCGCAAAGCGCTGAATCTGAAGTGCGTGCACCGTCAAGC
GCGTGCGCTTGATTTGGTCGAGCGCTTCGAGGACGCCGGCCTGAAAGTACACCTTGGTCCGGCCCAGCTGGTAGTGTGTCGGCGTCTCGAGGTTGAGGGG
TGCAATGAGCTAGTACAGTAATAATGAAACTTTGATACCATCTTGAAAGATGGAAAAAAACTACCGAGGCGCACTGCTCGGCGGGGTGTCCAGACGCAAA
TTTCCGGTCCAGCAAGACACGGTAGAGGTCGAGGAACGCGTCGTGCGTGTGTCGAATCGGGTATGCGGCGCGGGCGATCCGGATGGCTTCAATGACGCCG
GCGCACCGCAGCTGCGCGACCACCATCGTATGGTCCAACACGCCGGGCTGCTTGACCGCGTTGGGCTTGATGCAGCGAATGTATTGGACGTTGGTGGCTT
GGATGTTGGCCATGAGGTCGGCGAGGCTCGCCTTGAACTGCATGCCGACCGTCGTCGTGTTGAGCGCGCGGCCCTGCCGGGGCGCCGCCGGCTTGCCAAA
GAGCTCCGACACGAACGGAATCGACGACGACCGAACGAGGTCCGCGAGGTCCGGCAAGAGCGCGTCCTTGTGCTTTTCCAGGAACCCGGTCACCGTGTAC
GTCACGGGCGCGGCGTAGTGGAGGATGGTGAACTGCGCCTTGTTGGTTTTCGGAAACTCAATGACCGTGTTCGCGTCGTCCTTGTGGAGCGTCATGGCCT
TGGCGACAAACGACTCTTCGTTGCCCTACGCGTGGTGGTGAGGGGCGAGTTGTGGTGCTTTTTCAAGCTTTGTTCATGATTTTTCATGATTTTTTCATGA
TTTTTTCATGATTTTTCATGATTTTTCCAGAGATGGAATAGATGGAGATAGAAAGCGTACCCGCGGTCGCATGACTTCGTCGTCGAGGAGCGAGATGAGC
CCGAGCTTGGACTCGATGACGGCGAGGACGTCGGCGTTGTCGAGGAACGCAATGTGCGCCCACCGAATGCCTTCGTCCTCGTACTCGATCTGGACCGTCT
TGAAGACGTCTTGGGTGAACTTTTGCTGCAGCTTCTCGTTGGCGTAGTTGATGCAAAACTGCTCAAACGAGTTGGTCGTAAAGTGCTCGAACCCAAAGAT
GTCGAGGACGCCAATGTGATGGGCCATTCTCGCGTCGTGACTGAGCGACGCGTTGATCGTGGTCACGAGCCACTCGAAGAGACTCGCATAGAGTCCTTTG
GCCAGCGCATCGCGGCAGCCTTCGGCCTCGGCCTACACACCAAAAAACATCGTTTCATATCAATGTATCAAGTATTCCCAAATCTCAAATTCTCCAAATG
GGCCAACATGGATACCTTTTTCAAATAGACTTGAATCGTGTCGGTCGACGTGCGCACGGTGCGCGAGCAGATGGCCCGCGTGATCGCCGTCGTCTCGACA
CCGAGGAGCTTCCCGATCGCCACAAGGTGGCCCGTCGAGCCATGGCCGATGGTCGACATCTCATCGCCCTTGGGCTCGAGTTGGAGCTGCCCGAGGTGCA
AGATACCGGCGAGCGTCTGAAAGAGCGTCGTCTGCGCCGCCCCCGAGAGCCCGAGGCGGGACAGCGCCTGCGTGGTCTTGGTGAAGTGCGCTGCGTCCGA
GTCGCCTTCGATGGCCGTCGCCGTCGGCACACCCGTGTACGCATACGTCTCGGTCGGGTCCAAGAGGCAGTCGGGGCCATTGGCCGCGAGGAGCTATGGA
GTTGCAGCGTACGCTTGCAGTGAAAAGATGGATACCTGGTAAAAAATGTGGTAGTTGCGCTCCTGTGGCTCGTGCGACACGACGCGTGTCTTCTCGAGGA
GGTACGTGTTGCACTTGGCGCCGACCAGCGTGCCATTTGCGTCGAACTGCAGCTGCGTAAACTTGCCAAACCGACTCGAGTTGTCGTTTCGGACCGTCTT
GGCGTTCCCAAACGACTCGAGGAGTGGCGAGACATGGATGATCTTCTCGATCGTCGAGTCGTGGAGGCCGCCGGCAATGGCCGCGAGGTGGTGCATGAGG
ATCTTGGTCGTCTCCGTCTTGCCCGCGCCCGACTCGCCGCTGACGAGGATGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGACTGGTACGGGTTGAGCGCAATGCACATGTCGCCCGTGTACGTC
GTATGGATGCTCGGCGAGGAAGCGCGCCTTGACGTTGTACAAGATCGCGGCTTCGTGGAGGTAGCTGAGCGTGATCATGTCGTCGACACCAACCGCTTCG
TTCTGCATCGGCAGCGCCGACGACGCGCCGGCGTTCTTGGCGGCCATGAGCGCCAGCGTCTTCTTGTCGCGCAGGTCGATCTCGCGGACGCTTACCGCGC
CGTCGAGGCCGCGGACCTTGGCGCGGACCGTCTGCGCGATCGGGTCATGGGCGACGACGTCGGCCGGTAGCCACACATGCGTCTCGTCTGGCACGTACAC
GCGCGTCCCAGCGACCATCTCGAGGCCCATGCTGCTGCTGTCCT