Description :
From Genome Similarity Track
Location :
Scaffold_44:10334- 12402
Transcript NameFunction/comments
g7521.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569

Sequence
2068 bases(100 bases per row)
CGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCGACGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTATCTGTCGACACGACCGC
GTCGCCTCGGACACTTCGAGACCCTCTCGAATCCGATTGAATCAGGCCCTGCTGATTCGGTTCACATTTCCATCCAACGACTCTCGCAGTCGTTGGCGTT
CGCTTGGGATGATCCGAGACAGCCGCATTCCGCGCTGTCTCTGGTGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCT
CTGTCGCGCTGCTGCTGCTGCTGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCGT
GCCCAACACCATATCGAACTTATCGTCCTGGAACAGGACGATAAGCTCGTCGACGAACTTCTTCTCTTGATACGAGAAGCGTACACGTACGATACGCTTC
TCGGTCCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCCCTGCAGTCAAA
CATAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTT
CTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCAATGCAGCGTGTCCGACGTCGACACGCTCGACCGCATCACCAGCAGGGCGCCCCGCGCCC
TGCTGGTCCCTCTAGTTTTTTTGTTAGCCCGTGACGATACCCAGTATTGCGACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAG
TGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGAC
CTCCCGACGACCTTACCACCGGTCGTGGCATTAGCCGCGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGCCTAAACTCTTCTTGCATTGCGAGCACAAT
TGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCATCA
ATCGGGTTGGTCACGATGTTTGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCG
ATCGGAATTCGTTCTGCGGGGGCTCAAACGCTTGTTTGAGCTCCTCCTTGAAATCCTCGTACGTGCTAAAGCACGTAGGGTCTGTGAGTCGGCGTCCGTA
CGCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCG
ACAAGCCAACGGAGGAGAGGTTCCCCCTCTCTTCCAACGTAACTTCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAG
CTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAACCCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGCGTTCGCAACACCGTTGCTGCCGCCGC
TTCCCCGATGACTGTTGACAGTCGTCGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGG
CTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACCAACGTGTTCTTAGTCGGTCGTTGGACGGACTACAAAGT
GCTACCAGGTGTAGTGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGTGTATTTAACTTAAGTTCAGTAT
ACTTGTATCCGCAAGTATACTTAAACTAAGACAAAGAGACCGAACGATAGCTTTGGTGCCAAATGAGA