Description :
From Genome Similarity Track
Location :
Scaffold_819:10332- 14399
Transcript NameFunction/comments
Phyta_totarag10865hypothetical protein

Sequence
4067 bases(100 bases per row)
GAGCCGCGTAAACATGGCGGGAGTCAGAGTCATCAGCGTAATCTTGCTGATCTGCTCCGCGTTCCATGGCACCACCGCTGTCGCCAGCGTCGCACGAGGC
TGTCGAAGTCCTGGAATAAAATCTTGAAGCGGCCCGAATAGTTGCGAGTCGCCCCTAGGACTCGACGGCACCGGAGTCTGGGCGGAATCATCTCCAGTCG
TGGAAACATCCTCGCTGCCGTCAACACTGAGATCCCCAGGCAACGTCTCAGGGCCATCTGATCCGATAAGGATTGGGGCCGATGCCGTTCCTTCAGATGA
CGACAGTCGCCGACGACGAACTGTAGAACGGGATCTTGCCTGTACCGCTaacagctcctcgtcgctgaAGTCTCCGTCCTCGGAACCTCCGAGCTCGTCA
TCACGGCCGGAGATGCCTTGTTCTTGAGGATCAAGAATGCCGAGAGAAAGAGACGGACCATCATCGTTGATGTCAGCCAGACCCTCCACACCGGAGACAG
GGGCGGCACGATCAGTGAGACGGGTCGCTGTAGAGGCGCCACCGTGAGGTCCAGTCGCAGGATCGGGTGTAGGATCTGCGCGGGAAAGGGCGGTTGAAGA
TCCGAGTGAACCCATTGTTCGCGCAGACTTCCGAAGGCGACCTTGGTGTAGCCGACGATCCGACGACGTGTCACGGCTGCGTTTTGCGCTTGTTACAGAA
GACGATCGGGACGTACCACCCTGGGAGGACGCATGAAGAGCCGCAGACGCGATCCGAGCTAACTGCTGTAACGCCGCGTCACGCTCGACTCCGGCACTAG
CCAGATCCTGCTCAAGGGCGCCATGGACCTGGTTGGGGTTTCGGTAAGCTCCCTGGACGTCGACAACCTGAGCCTCGAGACCCCCAAGGACGCGACGAAG
ACCACCCATCTCTACGCCTGTGTCATTAGTACCAAGACGGTTAGGGCCCAAGACGTCGAATGCCAGCGACAAGTACTTACGCAGGTCGGTGATCTGTTTG
CGAGCAGCGTCTCGCTCCTGCACCACAGTACGGAGGGCAGACACGTCGGACTTGGCCTGATCCCGCTCACCGATAGCTTGATGCTTCTCGCGAGAGACTC
GCTGAAGATCTTGTTGCGCAGTATTGCACGCTTGTCGGACACGTTGGATGTTTGCCACTTGGGCGTGAGCTTGATCTAGCTCCTGCTGCAATCGCTGAGA
GTTAGTCACAAGAGCGCCAAGTCTGGTCCAGTTCCAAACGTACCTGTGTCAACCGATCTTCCAGTCGTtgtcgaccagcagcgtctctTCGTGCTTGATC
TCGATCTTGCTTGACTCGGCGGAGTTTGTGGTGAGCTTGGGCAGCCTGTTGCTGAGCTCGGCTAAGACgatcctgcagctggaacaCTTGGTGGTCCGAC
GCCCGAGCGCGCTGCGCCTGCGACTCGAAGTCTCGACAAAGGTTCTGGATCTGCCGTCGCAAATCTTGCTCAATTTGCGAGGATCTGCTAGACTTGGCAC
TCCTCGAAGTTCGCAGTCCCGCCAACTCGCGTTCCAGGTGATGAACTTgacgctccagctcggccTGATAAAGGGCGaggttgttgaagttgcggGCAGT
TTCGGTGACAGTGCGTTGCGCGTTGTCACGATCCTGCAGAGCCGAACCCTGAGTCGCCACGGCTGCTCGTAGCTGACTCTCCAGATCTACCGACTCTGCT
GTTGGGATTCCCCCCTTGTAGGTTGTCAAAACTACCCATTTTAGTTCAAAGGGGTACTTTTCCAAAATGCCCCTTTTGCAGAAGCCTGGTTGTGCTGCGT
TAATAAGTCCACCAACTTTTCTTTACTCTTTTATATACTCAGAATTATAATCCGTTTTATGTGTTGTGATCACCACGCATTTTGTCCCCGCTACTTAGAG
CACAACTTGGTGTTCCTGATGGATTTGAATACATTAAATCAGACCTTTAGGACGTTGGTAATCTGGATGTAAATGAGAGTGGGTTGACTTAAAAACGCGA
TGGAGATGGGCAAAGGTACTGAGCTAAAAATTCATCGGACCTCGCCAGGATTTGTTTGACCAATCATGTTCAGCTTAGaatttgaaaaatggcgcgctTT
TGGCGACCTTCGCCTTGCTGAGCACCTGCAGAGCACTTCATATCTGAATTTGCACGTGCAATCACAAGCCCACCAAGTCCTCTATGCCCTCCACCCCAAC
CAAGCGCCTCCGCCTCACCTGAGCTGAAAAGAtgggcatcatcgacaaggccGCGCTCTCGCCGACCATGTCCTCCTACAAGAACATCGCGAACTGGGCC
TTGGCAGAGTTCAGTCTCCCGGCCGCTCCGGCAAGACGACAATTTTGGATATTGTCAAGTCAAaagctgcgctgctgggGCGGCCGACGGAGAAGGTTAC
GCGCAAGAATGTCcacacgtgctgctcgatgagaacatcgtcgacttcatcatGCTCGCTGAGGCTGATGGCGTGAGCCTCAGCGGAGCTATGATCATCG
AGCATGCGAGGAAGCTCATTATCAAGCTTCGAATCCCTCCCGAGTAATGCCCCCGGGGGATCCGTCATGGCTGCGCTGCTTGCAACCTCGCTACGGGCTC
AAGTGGCGTAGAACCTTTGGAGAGTCCGACTCTGCCAAGATGGACGCCGCCACGGACGAGGTCAAGCGCCTCAAGAGCATCATCAGCTCGTACTTACCGT
GTGACGTGTTTAACATGGATGAGAGTGCGTTTTTTTTACAATGCAGTACCGCAAGGTTCTATCTGTAAGAacgctgctcctgctctaAAGCAGAGCAAGG
CTAGAGTTACTATGGTTGTCTGCACCAATGCAGATCGTTCTGAAAAACTACCTCTTCTCTACTTAAGCACGGCGATGGCACCTCGGTGGTTGCCCAGAAA
GCCCACTATTTTGGCACTGAAAAGGTGTAATGGGtctacttagcccaatacttaagcttacacgtgtgcgcacgtgtatgaggaagcgtaggtttcNgct
tctgttaggttacaagtgatgtagccacttgtacgtgtaaccccgttacaaagGGGTGGATGACGGGTTGGATGTACCAGCAGTGGGTGGTGGGGCTTGA
CGAAGCGATGCGCGCTCAAAACCATTTTATTCTACTGCTCGTAGACAACCCCTCATCGCACCATGAGACGGGCCTCTCTCTCGCTAACGTTCGGGTGGAG
AAGTTGCCCCCAAACACTACATCGAGGATCCAGCCAATGGATCAGGGGATCATCCACTGCATCAAAAGGTATGNTTTAATTTCCGCCAAAACCTAGCGTC
TAAGGCATACAGCCGGATTTTTTTTAAGTTTCCGCCTttgttaagtgtcaccccaTCGCATTGACCAATTGGATTGGCCCTTCAGCCTTATCAGATTAGG
ATTTGCTCCTatgttaagtgtcacccAGTCGAAaacacaccagcagcagctcacacCATCCCCAACGTGTAGCTTCTGTTCTAACGCACGACAGCATCCA
GCCCCTGGACTGCTATGAACTACATGACTGGTTTTCTTGTTGAAGATACTTTCGAGTTCCTAAGTCGCATAGTTATGACAAGTTTCCTGAGACCAGCACG
GCTGCCCTTCGAAGACTTGATATTTTACGGAGTGGCTCAATTATGCGGGTGATCAAGTATTTGAAAAGGATACTCTTCCTGAAGAGAGCTATTAGAGAAC
GTTAGTTTGTGGAATGTATTTTCTTCGGAATAAGGAAAAAGCCGATATAAGCCGCAAAAAACTGTGGATGACTTACCGCCATACCAAAATCTTATTCCTA
TGGAGTAACAACTGGGGCCGAGTGGTATATCGCACGGAGGAGGTCGGTAATTTATGCGACATCTTGTCATTTTCGCTATTGCCCCCCCCTCACACACACA
TTTGGTTGATGGTGCCGCCGGACGATTTAGACGTGCTGAACCATAACATGCGTTTCGAGTGTGACGCAATATAAATCATCTTTGACCGACGATCGTCGTC
ATCAATTGGAAGCAAGAGAACCAGACGCAACCACCTAGAGGTACTTAACGATGCCGACAAAACAGGA