Description :
From Genome Similarity Track
Location :
Scaffold_2840:1033- 2512
Sequence
1479 bases(100 bases per row)
CGTCCGGACATGTGGAACATGTCAGCGGGTCAAGTCTGCAGGCCACGCATCGACCCCGTTTCAGAGCCTGCCCGATCCCAGCGAGTGTTGGAATTCGATG
AGTCTCGACTTTAGCTATCACCTGCCAGCTGACGAGCACGGTAGCACCGCCATTTTGGTGTTAGTGTACCGTCTGAACAATATGGTATATTCTTGCCCCG
GTGCCGGAAACGGTCACAGGAGAACAGGCCGCACGACTGTTCTTGGACAACGTGTTCCGCCACAATGGTCTGCCGGAGACCATTGTCTCGGACCGAGACC
TGCGCCACCATTCGTTCTCATTGCTGGAACCAGGTTGCTCATGTCAACCGATGACCAGACGGACGATCAGGTCAGACCGAGCGCGTCAAtcgcgagctcg
aggacaCTCTCCAGCGTGTCTGTGCGGAGGCGCCGCACTGGTGGACGGACACGTTACCCATGGTGCAGGCTAAACCGCACTCCGGGAAAGCAAATATGAA
ATACCCGAGCTTCGTGGGGGAAACTCTCTCAATGGTGATATCGACTTTACCTAAGGATTCAGTCTTTTAGCGCGGATCCCCGATGCCGCGTCCGTCTCCC
CTGGTTCTAGTCGCTGGaaacgagctctgcgcgcttgaggggaaaagtaagactgaattGGGCATCGCCTCGGCCCGAAAGCCTTGGGCGATGCTTAAAT
ATATGGTAGATCCTAGGATCTGCTTAACTACTTGTTTTCACTATGGTCCGACTTGGCTATACTATGGCCGCACTGTCTGCGGTCATCAGCTGCGCTGTGC
TGACTCTCCGGTTCTCTCTCCTTGGAAACTGGACGATCACTGTACTCGGAGACTTGGCTTTTTCGGGAGCACAAAACTATGCCGGAATGGTCGGCTTCCC
CGAAAACCCCGGGGCACTGTGTCACACATGCCGCGGAGCAATCCGTGACCAACCCGTCGCTGGGGCTGGAGACACAAGCCTTGGTGTCTCGGAGGTCGCC
GGGACCCTACGCTCCAGCGATGGAGTGAACGACGTTCGAGCTACATCCCAGAATCGCCGCGCCATTGGCATCCCTGCGCGACGTCTCCACAGGAGGTGCG
TTAGTGCTTGGGGGCCAATTCtccgaggtgcagcagcgagagtaCGCGGACAGTCAAGTGGCGCGATGAAGGCCTCGAGGCCCTGGGACGGTGTCGTCCC
CGGACCCGTACTACCCGGAACGACGTCACTGGCCTATGAGAAATCGGCTGATGGAAGTGACCGAAGCTATCCGATATCGCCGAGAGATCAACGTGTCCGG
AGACCCGGAGCGCCCCTGGatgcagcggggctgcgtagcgtagtgcgtcagaggaagacgtatgactctccgatTTTTAGCTTTgtggttctccgaaccc
ctaagtctccgcagaggcttagatcactctagtatcactaactagagactcaacgagtcggtattcctaacccaaggta