Description :
From Genome Similarity Track
Location :
Scaffold_35:10327- 11441
Transcript NameFunction/comments
Phymu_g2069DEAD/DEAH box RNA helicase, putative

Sequence
1114 bases(100 bases per row)
tagccaccgccgccgccataGCCGCCACCACCGTAGCCACCGCTCCCACCACggccaccgccgccaccgccacgctCTTCGTTTCGGAAATCCCTAGCAC
CGAAGCGAGAGCTGCCACGGCCACCACGACCGCCGCGACCACCGCTgcggcctcctcctcggaaGCCGCTGGTGGCCATCTGATCCAGGAAGGCCGGAAC
CTCCTGGCCATTCTCCGCCATCAGCTCGTACATTTCACGGGCGATGTTGCGGTTCTTGTCGTTCATCATCGAGAGAGCGTAACCAATGTTACCCACACGA
CCAGTACGACCGATACGGTGGACGTAGTCATCAATGTTGTTGGGCAGGTCGAAGTTGATAACCTGGGTCACACCGTCGATATCAAGACCACGAGCAGCCA
CATCAGTAGCCACCAGCACGGGCGTACGTCCCGACTTGAAGCTAGCAAGAGCCTGCTCACGCTCACGCTGCGAGCGGTCACCGTGGATCGACGTGGCAGG
GAAACCTTCGCGGCACAGCATGTCCTCCAGGAAATCAGCGCCACGCTTGGTCTCGACGAAGACCAGAATCAGACCGTCCTGCACCTGGTTCAGGAAACGC
ACAAGGTAGTCCTCCTTGTCGTACTGCTCGATGTACTCGACCGTCTGCTTCACATCCTTCGAGGCCGAACCCACACGGCCGACCGTCAGGAAAATGTAGT
CGCGAAGGAAGTCAGACGCAAGTCGCTGGATCTCGCGCGGGAACGTAGCACTAAACATGAACGTCTGACGCTCACGCGGCATGTCCTCCTGCTCAACAAT
GCGGCGAATCTGGGGCTCGAAACCCATATCCAGCATGCgatcagcttcgtccagaatCAGGAAGCGGATGCAAGACAGCGAGATGCGGCCACGCTCCATC
AGGTCGACAAGGCGACCGGGAGTGGCAACGAGCAGGTCGCAACCGCGCTCCAGCTCACGCAGCTGGCGACCGACCTCAGCACCACCGTAAATGACCACTG
GGGCGATACCAGTGCAGTAGCAGAACTTCTTGGCTTCATCGTGGATCTGCGACGCCAGCTCACGCGTGGGCGACAAGATCAGAGCCGCCGGGAAAATCTT
GCGGGAGCGGCCGT