Description :
From Genome Similarity Track
Location :
Scaffold_45:103269- 104301
Transcript NameFunction/comments
Phyra_80021tRNA (cytosine-5-)-methyltransferase, putative

Sequence
1032 bases(100 bases per row)
GCATCGTCTTTCGCGGAACACTTTGCGCCGCGCTGTGGTGACTTGCGGCGCGGGTGATACGTTCCCTGGTCTCTACGATGCCGAAACGAAGACCTTGCAG
CCTACCAATGTCTTCGACCGTGTGCTGTGCGATGTGCCTTGCAGTGGTGATGGTACTCTGCGTAAGAACCAGGCGTTGTGGAAGGAATGGCATATTGGCC
AAGGCCTCACCTTGCACCCGATTCAGCTGGCATTGGCCCTACGTGGAGCTGCACTGCTCAAAATTGGTGGCATCATGGTGTACTCAACGTGCTCGTTCAA
CCCTGTTGAGAATGAGGCTGTGGTCGCGGAGCTGCTGCGTCGTGCTGGAGGATCACTGGAGCTGCTAGACGTCTCGAAGAAGATGCCGCAGCTCATTGCG
CGTCCTGGCAGATCCAAATGGCGTGTTGGCTGGCGTTCAAAGTCCAAGTCTACGCACAAGGGCCATCTCTTCAAGGAAGACAACAGCAGTGAATCCCAGG
GCCTGCACCAATGGTTCGACAACTACGATGCCCTCTCCCAGGACCTGCGTGGCCGTGTTAAGCGCTCCATGTTCCCGACTGAAGGAGCTATTGCCCAAGA
GCTGCACAAGACCCTACGACTCATTCCGACGGACCAGAACTCAGGAGGCTTCTTCATCGCTGTGCTGCGCAAGGTGGCTGATTTGCCTGGTGAAGAAGGC
TACCAAGAAGGCCTCGCTCCGCTGGAAAAAGTGCTGGCGACCCCACCCGCTGACTACGTTTGCAAGCTCTGTGGGAATGGAGGCCACTTCCTGAAGACCT
GCGAGAAGTATTTACCGGACACGGAATTCAGTGCTTCTAACTCATCGCTGAAGCCCAAGAAGAAAAAGCAGCGTACAGAGGATTCGACGGCAACGGCAAA
GAAGACGGAAAAGAAGCGTGAGACGCTCTATCGTCCAGTGGGGGACGATGTGTGGCAGCAACTGCGTGATTTCTACGGCCTGCAGGACGAGACCTTGAAG
GTACACATTGTAACGTGCATTGGACATCAGAG