Description :
From Genome Similarity Track
Location :
contig_38:103241- 126073
Transcript NameFunction/comments
g7065.t1hypothetical protein PHYSODRAFT_469584
g7066.t1malate synthase
g7067.t1hypothetical protein PHYSODRAFT_248423
g7068.t1hypothetical protein PHYSODRAFT_353505

Sequence
22832 bases(100 bases per row)
ATCTTTGGTTAGAGGAGGAGCTACTGGAATTTTTCAGTACGAAAAACCCGAGCAGGTCTATTCCGAAAATTCCAAAACACTTCGGATCGTGGCCAACCGA
AGTTCTGTGAACACACTACAGAGTTCAAAAGCGAGGCTATAGCGAAGGTAAAGATGCACTGGGACAGCCTGGATAACTACCGAGCTGTTGCGACGAGATG
TTTAGATGCTGTTTGGGCGTGGCGTGAGTTCAATTTTGTAATTCGAGATACGGATAATGCGGCGGAGAAGACATTCCCGCTGGCATCGGTATGGCAGCTA
TTGATTCGAGCTGGTGAAGCAAGCAACAAAACGGATAATGATTTAGAGGTAGTAATGGCTTGCTTCACGAGCTACCTGCAGCAGTGTGTCACCATGAATA
TTCGTGACGAAGACCGTCTCCTTTTCAGATTTCTGCTGGCTTTTCGTATATGGCAGCGACGCATGGTGGATGAAAGCTCACCGTCACCTCGTTTAGCGAC
ATCTGAAAGTAGCGCACAAAGCTGGCGTTCCACTGACATGGAATTATTAGCACGTTTGCTAGCTTTGGTTAGCTGTAAATCTGTCCACAATTCCCATGAT
ACCTGCCGACCAACGCTGAAACGTTTACTTGCACTTCGTCCTGCCGGCATGAAATCTATTGCTTGGTCTGCGGTCTGCTATTTAGCAGAGGCATCTGGGG
CTCTCGACAATTTATCTCGAAAATGGAGAGTGTGGAAGCTGGGCAAATTGTGTGGAAATCGCTGCTCGAGCTGGGAACAAGTAGTTCAGCTGATTGGGCT
GTGCACATTTCCCTTGACGCCTTTACTCGTTTGTGTGTCGTTGTAGCTGTCCATCCGCATCGATTTTTGTGCGAGCTTGAGGACTTCGCCGAGCGAGAAC
TACAACGAATTTACAGTTTTCCCGCGACGTCAACACAATCAAGTACGAATATGAATCTATCGTCACTTTCTTCTGTGGTGGCCGCAGCATCACACTCATC
AATGACTCAAGCCCCCGACTGGCATCGTGATTTATTCTGCATGTGGCAAACATGTTCAAGTGCAAAAGCCCCGCTGGTAGTATTTTGCCCACCAAACATT
GATTTTATGGATGCGGTAACAAATGTGGCGAGGCGTGCTGGGGCAACGATGGATACGACAGACACTATCCAGCTACTGCTTGCCGACGAATCCACTTTCA
AGAAAATACTGCTACTAGCTATGGAGAAGGGTCAGTGGGTAGTACTTCCAAACGTACACACATGCCTCAACCAAATGGAGCAAGTGAGCAGTATTTATGA
ATCATTGGACGATGGGCACGCTCACTCGGATTTCCGTTTATGGATATCAGTGTCAAAACAATCCGTTGAAGATCCTGCAAAGTGGCAAGCTGATTTTGAA
AACAGGAGGATTAATCGAATTGCTACACGACGAGAATGGGGAACTGGGTTTCTTTCATTAAAGCGGAGCCTACACCACACATTTGCAATTTTGAAGCATG
AGCTCGATGGTTTGTATGTTCAAGCACCGTTCCAACGCTCCCTACCTTGACGTCAGCAGGTGCTTCGAGATTGAGTGAACACGAAGAGAAAATCATGAAG
CAACTCGGTGTTTTTCATGCACTTGTCTCGTGTCGTGACCATTTTCAATTTGCACAGTGGAAAGCAGAAGAAGAATTTGGGGATACAGAATTGTATGCTG
CAATTCGCTCTTTAGTGGTTCTACGAACAGATGAAGAGCTGTAATGAAGGAACCGAGTCCTCTGTGTGCGCCCAGCATAGGAATGTGGAATGAAGTGACA
CTGCGTGGAGTTATCTCTAATGTCTATGGATCAACACTAGAATCACGGCAAGATCAACTGCTGGCTCAATCCTGTATTGATTTTGTGCTTAGCACATGGT
CAGAATTGCAAAATGAACACGAACTTGATGCTACAGCAATTATAGGTCGAATGGCCTACCGGAAGCTGTGCTTGTTATCGAAAAGCTGGCCACTATCCAT
GGATGTCAATCGTAAGCGCCATCTCCCACCTTTGGATAAGTGAATCTTGCGGACCGTCTGCACTGACAAGTGGTGGATCACCATTAGACGGTATATCGAT
ATGGGATCCTCAAAACATGCGCAGAAACCGACAGAAGAAAATCACCACGCAATTAGCAGTCCTGGTAGAAAGCAGAGGATGTCAGCTGCATACTCGATTA
CTACCTGGGCGCTCACTTCGCAATATGGAAGTGCTCCCACTGCTCGAGCTTCTCGCTGAATTTGGAAAGAATCTCGAAGGTGTTGTATTGCCGTCCTCGT
TGGGTGATGAGTACGAGTATCGTAAACCGATTTCGGCTCTTGTTAACCATGAAAGACAGGTGCTTGAGCAGATACGAGCGGTGATTATATGTGATATTAG
GAAATTGGAAACGGTATGTTATCCATTCTACTGCTTTCACTGCGATCACTGATATCTAACTTTTTGTTCTGACGCAGGTCGGCTTTCGGGGTCGTTTTCT
TGATTCAGCTACGCAGCAGATATACAATGAACTACGACACAATAGAGTTCCCGCTAGTTGGCTCGCACTACTTCGTCTAAACACCGGTGGGCCGCAAAAG
TGGAGCTTCGACAACTTTCAAAAGCTTTTGCTCGATCGACTTAACACGTTCGCGGCTTGGATGGAACCGGACGATGGTTCATACAAGCTGCATCTGGATA
AATTCGAGGAGCCTAAGGTGAGTTGTATTTTATGCAATTTGAGGCCAATCATGCTACAGATATTCTGACGATACCTTGTTCAAATATTTTTCTGTGTGTG
GAAAGCATGTTTTTGAGGCTGTTCATCAGCATTTCGTCCGTAACCTCGTGGGCAATGCAATGTGCTATCCTGACTGTTTGAAGGTTATCTCGTTATTCGA
GGATTCTCCGAAACTCACACTGCCGATGAAAGAAGATGTCATATACCTCACTGGTGTTCGAGCTATGGGCCATTTACAGCTTCAGGTTATTGATACCAAG
GGCCATCTCCGTCGCGCTCCCATAGCTCCTTACGGGGTTCCCGTGATCCTACAAGTAACCAGTTCATGTTTATCAGACATGCGTGGAATCTCCGTATCGC
CAAAGAGGCCTACTAGCGCGACATTAGAGACGAGTAATGATGGTGACAAGACAAAAGCTGAACCGACCAACCATTCAAGTGGGACACGAGAATTCCTGTG
CCCATTGTTCACACTTTCAGGTGGGTCTGATTTGGCAAACGTGCCGAGGCCAGTATCCGTGTGGTTAGCGCGCTGCCCATTGCACAACTCGTTTTCAGTG
GAGCCAGCTTGGAGCTTCAGACTGTCGAGTAGAGCAAACATTAAGATGAATCCTAACACCGGCATGTATGTAAGTTAAACGTCGAACGCAATCGCGTTTG
ATACTATTTTGCTTTGCCGGAGTAGAGTTGTCGAGTGAAACGTATAACTAATGGGATATCCGCCTTGCGCATGATTTTTTCGCGGCCATTGGAGTTGTCC
AACCACTGAAGAAGCCCTGTGATCTGCTGTTCAGGTGTTTCGTAACCAGGTTTCGAACTGAAGAGCTCTAATGCAAGCCGGGCCAGCATCATTCCAAACC
CCACCTTCTTTAGTGTCTCGGCGTCGGCACCACTTGGTGGGTCCTTGTCATGTATTGCAAAATAGACCTTGAGCAATCCTGCTACCTCAGTATGCAAGCG
TTTCAGGCTCACACGATCCATGAATGACGGGATGAGCTCAAAGTCGATCGCGAAGCTGAGCACGAGATCAAAACTCAACCCGAAGAGTTCGGTTTTGGTC
GTCGAGATTGCAGCTGTAGCAGTAGCGTTGGGAAAATGCTGAGAACTATAGAATTCACAAATTGCACCAAGCGGTCGCTTTCTCGGCTTAGAACCCCGTT
CATTTCCAGCATGGAGATACTACGTCTTCGCGTTTGTGAGAACAGCCGATGGAAGGTGGAGGGTACAAATGCCAACGTGTTTCACCGTCCTGGACGCCTG
AGCTCTTAGAATTTCGAAGGAGTTCGTTTTCGTTGCCGTGACCCAAGTGGAGAGCCAAGCCAGTGAGAATGCTTTTCATCGCTCGACTGAACACCTGCGA
AGGCGAACCAACACTGGCCCTTCGCCTGACACCACAGGAAGAAGGTGATCTGCTACGTTGGTTTGTTGAAGATTGGCATAGAGTTAGCTGCTGTCGAATG
TATGGCCGCAAATACAGTGCCACTACTGTCTGGAGTACACGTAGTAAATCGATCGTGGGAATCTGCGCATGCCAATCAATGTTACTGCCTCGTTGAATGC
ATCCATGTTGAAAAATCTATAGCGCGTGGTATCACCGGCAGGGTTCATTGATTTTGAGGGAGTCGTCTTCTTCGTTGTCTTGGCCCAACCGTGTGGTGGT
GACCATGTTTGCTGCCCTATAGTAGTGAAATCTTTTCGTACTAAGGTAGTTTTCCGGTTCAATTGAGATTGCGCCAACACTCCAGCCAGCACAACATCTA
CATCCGCAGGAAGGAGATGCGGAGCTTGCACCAATCCACTCTCCATGAAAAATCGACGAACAATTGACACGTGCACGCCCACCTCATGGCCGCTCTCCAC
GGTTATGTCTAGCGACTGAAACAAAGAGTTCAAGCAACTTTGGATCTCCGCTGTTCCGATTGAGTTTGGGTCGTCGTTGAGAAAGGTTTCCACACAAGTT
TGTATAGGATGTACACTTGTGGGTCGATGTAATACTGGTACAGGTGTAGTTGAGTTCAGTGGTTCTGATAGATGACCGGTTAGTGTTTCACTTGGCAGGG
AGTTGCGGCGAGATATCCCCTTCATGGAAGGGTGAATATTAGAGCGATAGGCTCCTTGATGAAGCGCTGCTACCTTTGCCAGCTCGCTGAAAACCCCTCG
TCGGCGAGCATCGGTGTCTTCCTCTCGCATTGACAGAGCTTCCAGACCCTCACGACGGCAGTCTTCAAGTTGTAGTAGCAATTCTGTCTGCGGAATAACA
AGGATAGTTGCTTAGGTGCAGAGGAACCCACATCACGTAAGGGAATTTCGTACCTTTTCATGTTTCAAGATTTCAATCTGTAACAGCGCATTGTCACGTT
CAACTTCCGCCAGTTGTTTCTCATGCTTGCTTTCACGTGTCCGCATCAGGTACTCTGTTCTCATGGCTTCTTTTTGCTGCAGTTCACGAGTAGAACTCGA
CTGTTGAGCTGCCAGTGATTTAGCCTCTCGCATCGATTCGTTCAGCGCTAACGAGAGTTGCTCACATTGTGCTGCCTCCGCAGAACGAAGCGCTCGTTCG
ACCTGACATCGGCGATCCGCTTCCGCCAACAATGCCTCTAATGACCGCATGCGCCGAAGTATTTGTTGATGCTCATCTGCGTGACCGGAAAGACGCGCAT
TCTGAAGAACTAAAAGTTTAGTTTGCTCCTTCGCGCGACGAAGCACTATGCAATATCGATTTTCCAGCTCACGTGAAGCCATTCGTACACGGTCCACCTC
ACGAGCACTCGCTTCATATAGCACCTGCCAGTTTTCAGCCTCCTTATATGATGTGTCGAAATGAGGCACCGTTTGAATAGTGTTTGATTTCGGAAGAGCC
TGCCAGTTCATGCCTTCTGTTCTCGGTGCGCCTGAGCCTGATTTTGTTGTAGCAGGCTCTGGGTCTTGCGATATTGCGTGCAACAGTTCTCTTGTGGGGT
TAAATGAACCTTTGCACAAACTCTAGCACCATTTGGATTTTTACACAGCGCATCTAGATCATCCTCAGAGCCAGCCTCAGCATCGAATAATTCGGGCTTG
GCATTTGCACTACTGGCCTGGGTTACTTGGAGGAAACGATCAAAGTACCCGGTGCCCTCACTGAGGAGAAGTCCGTCTCCATCCTCGTTCTGTAGATCAT
TCATATAGGCAGGACTTCCGTCCGAATCGACCGGAAGTTCGTCTCCGCTATCATCATCCGTGTGCGCTGATGTGTGGTAAGGCATCGTCCGATGCATGTG
CGAATACATGAATTCCTCGTAACCATTGTAGTCATCGTTCGTCGATACTGAAATATCATTTTGGGGCTTTGGAGTCGCTTCGAGGCTCTTTGTATCCAGC
AAGCTCTGTAGCCGGGCTGCAACAAATACCATACGGGCTTCATTTTCAATACTTGCAACTTGACTGTGGTGTAGAGCTTCCACTTGATTTTTTAAAGCTT
TCAAATTTACCGAGGGGAAACAGTATCAGTGAAGGATTGAATCGAAAAGAGCAAGCAAACTGAGAACGCATGGGTTTACCTTATTTGTGTGACGCCATGA
GCTTGTGAAGAATTCGAGAGCATTTGGCGCAGCGTTTCACACGTGATGGGTCTTGTAGTAGTGTTTCGAGTAGCTCTACAAAGTCACATGCTACATCATC
TGTAGCCGTTGTCGACAATCCATTCTCTGCGATCTCCCAAACATTACGCGAGCACAATGTTTGCTTCACGGGTGGATGCATGACCATACTATTGGTTTGG
CAACACATCCGCACAGCATGTATTAGAAAAGTGAAACAATATACCGTCAAAGAAAAGAAAACTGACCTGTTCAGTACCGCAACACCATTTGCTTGCACGA
GTTCAACGCTCTGCAGCCCACGCATTGCATCTAGGACGGCATTCACCACACTTTGAAAAACGGCAGTATTAGCAGTTCGAAACGGAACATTTGGACCGCA
ACATCTCGGTACTCAAGCTCCACACAGAGGAAAATAGCACATCCAACGCTGTCACTACGAATTCGGCTTCCTCCACAAAAACGGACAAAGCGCTCGTGAC
CGTCTGAAGCCCTCCATGCCTCAAAATGCGCTCTTTACTGTCCTCTTCAAGCGCCATCTGATGGAGAAATTGGCACGCTCGAAGCTGCACAGCAAACACA
GTCGCATGTTTCTGCATGACCGAGATACACAGCCGTATCGTATGTGAGACCTGCAAACTCGGTCGGTTCTTACTATCCGTCGCTAGTGACTGGAGCGTCT
GCAGAGCTGCCGCCGCCTCAAAAGCCGACAGTGTGGAAACTTGCTGATCGGATTCCCACAGCGAACGATCAAGTCCGCGACGCCGTCACGGACGAGAGCT
TCACGCTCTTGCTCCCCACGACTGCTCACTTTTAATAGGACGCGGTTGACGCACACGAACACCGTCATGAAGCTGTCTCCTGCGTCCGTCGCCTGCCGCG
GTTGGCAATGTCCAATAGCTCGCGTCACTCAGCACGGACCGAACACATGCCAGCGTCTTGGTGAATGTTCCGTCGCCCACACTCAACTCCTGCGGCTTCA
AGGACGTCAACAGCACCTCCAGCGCTCGCCACAGCGCCCGCGCTTCAGTCACCCGCTCATTTCTGCGCGGGTCGTCGTCTTCATTCGCGAGCTCCCACAA
CCGATTCCCAGCAGCGCGTCCATCGCGTCGTCGAGAAGATCAGATAGTGCACAAACCCGCACAGGTATTTCTGCGCCTCCTTTATTTTCGGCAACGGCTC
ACTTCAACTTGTACCAGTCAAGAGCACGCAATGTACCACGTATGCGACATCTCTCAAGACAGCTTCTCCCAGTTCCCCATTACGCCACCAGTTTAGCTAG
CAGTGCGGTGGCCCCTGCCTCATACATAATGGACTCGACAGTGCACGCGACGCCTTCCCTGCCTCCGCCAATGAAGGCTGCGTCCACGAGCGACATGGAC
GATCACGAGGCCATGAGTCTGTTCGGGGGTCCTGCAATTACGGCGCCTCCCCCGCGCCGGTTAAATCCGTTTCCACTGGAGCCATCGCGGACGACCACGG
GAGCTACGACCTGTTCGGCTGCAGCGTCCGATGGCGACCCCAGTGACGAAGGAAGCTGCGCCCATGGCAAGCACCGCGCCTGTGGAAGATGGGGGCGTCG
GGGAGGTGCGCGAGCCTCTTTCTCCAGCAAATTACGAGCTTTTCCCGGCGTTGGCGTCGACCGAGAAGCTGCAAGATACTGGGACAACAGAGGGTGATTC
GGAGAGCTATTCCCGTCCCTCGAGGGGACTCATGGCAGCAGCAGCAGCAGCAGCAGTGCTACGTCTACGATGAGCGGTGGAGGATCGTTCCGTGGAGAAC
CCCCGCGTGCCAACAGTAACGCGCTACAGGTCGTGTCGTCTGGGGACCAACAGAGCTCCCCGCCGACGTACAAGATGGCGGGCAACGCAGTGGATATTGT
GGCGGTGAAGAACATGGACGGACAGTACCTTACCACGTCGTGGCACGTGTCTTTCTCGTGGTCGCGGTTTCGATCGAGCTATGTGACGGGTGTGGGAGAT
ATGGTGAGGATCCTGGTCAATGGCAAGGAACTGCCCACGAAGATGGAGCTGCAGGAACGCGGTCGGTGCGTGTTCATTACGGGTGGAATTATGATCCCAC
CGGGCGACCTCCTCTTTGCTGATTTGTCGGACGACCACCCCAACCACGTGCGCTTCGAGCACTTCCAGAAGTACACCAACACCGTACGCTATGTAGACGC
CAAGCTGCATCTGTGGGGGCCCAACGAATCAGTTGTTGTGGTCGACTTGGACGGTACGCTTACTATTAGTGACGTGGAAGGCCATATCCGCACACTGCGT
CTCGGTCAGTACGATTTCCTGCATGCTGGAGCTTGCGACTTCTTCACCAAGTTGCACGAGCTGGGGATGCGAATCGTGTACCTCACTGCGCGTCCACTCG
ACTGGGCATCCGCATCACGTACACACTTGGAGAACGCAGTACAGAATTCGTGCCCACTTCCGCCAGGAGTTCTCATCACGAACTCGACTGGTCTCACTGG
CGCGCTGTTCACAGAGGTCGTGAACAAGACGCCGCACGTTTTCAAGATCCAGGTGTTGAATGAGCTGCAGCTTACGCTCATTCACGCTGGCCGTGTGATC
GAACAACCCGTCTTCGTCGCTGGCTTCGGCAACCGCCCCACCGACATCGTGGCCTACGAGGAGGTGGGCATGGATCCCAGCCTCATATTCATGCTAGACC
GTATTCCAACCTCAAGGCTGTAACTGACCCGCGTCTGTACGAGTCCTACAACGACCCGAACGCGCTGCTGTGGATGCTGCCCAAGCTCAAGCACCGCGTG
CCCATAGAAAAGGTTGGTCGTATCGACGACTACACTGTGCGAGAACTCGTTCTAGCCGAAGACCGTGAGCAGCTTCGCATGGCCGAGATGCAGGCTCGTC
GACTGCAGCAGGAGGAGTTCGAGCGTGCCCGTCAAGAAGCGGACCAAGCTCGATACGCTGCGTCCAACGTTCTCCGCGCCAGCAGCAGGAGTCTCTCCAG
GTAAAAACACAGCAAAATGGCCAACCATCTCGATTGTATGACTACGTACAACAGCAACCAGTAACTTTCATGCAGACACCACCAAAATGCAATGGTGCAA
TCATAACAACACACCATACAAAAGGAAATCAATCGCCACGATGTCATCTGTTCGTCTGTTGTCGCGCGCTCCATGGGCTCTAAAGGCCCCGCACAATGCC
GGCAAGTCAACTCTCGATCTGCTGCACAGCATCAGCGTCAGTATGAGTTGCTGGTGCCTGGGCTGCAGGCTTTCCGGCGTCGTAACGGCCACTGCGCCGT
CCCGTTGCGCTTTACAATCCCCAGCAGCCACGATGCAGACGCTCCGCAATGGCCTCAAGAAGTGCAGGGAATGAAGCTCGGCACGCCATCTCCCGGTTTC
TAAAAGCCTGTGCGTCGGCCAAGAACCGTCGCGACGTCGGGCTTTGGACCATGTGAAATCGCAACTTTTGGCGGTCTGGGGCTGGCGAACATCGAGGACT
GGAAGCGCTTCCTCTGGGAGGAAGTGACGGTGCCAGCCATGCAGACATACAGCACCGAGTATGGCGATCTGTTGGTGCCAGTGTCGTTCACGGTACCGCA
TGGAGATGGCTCGTGGCCGGTGTCAACGTGGGGATACAAGTTGGGTTACTGGGTAAGCGAGCTACGACGCAGCAAGGACAAGCTGCTGCAGTATCAACTG
GAAGACTTGGAGGCGCTGGAATTCAGCTGGAATGCTCGTGAAGCTCGGTGGAATCGCTTTTTTATTCCTGCCATGCAGAGATACCAAGAACTTCATGGCA
GTGCACAAGTACCGCAGAGCTTCGTGGTGCCGAGTGACGATCCAGAGTGGGCGGCGGAGTTGAGGGGGTATCGATTGGGACAGAAGGTGAACAACTTGCG
CTGCGGAGACCCGCTTGGCACAGGGCCCAATGCAGAGGAGTGGCAAGACGTGGAGCTCATTTACAAGAACTGGATGCTACTGGAGACGCTGCACGAAGTT
GAAGGCAGTGGCGTCCTGGATGAAGAAGTGCTGTCGATCAAGACAAACCAGAAAAATAAAGCAGCAAACCGGCACAGCTCTTGATCATCAAGGTTTCGTG
CATTGAATTATAAAATATCGTAACGACACTTGCCCTTAAGTCTTCCGCAACTGGTGCGTAAACGTCGGCACTCAACCATCATGTCATCGCCAAGAAGTCC
CACCGCTCAACACTCCTACCATTCGGATCGCTCATTCAAATCGTCCTTGGCTTGACAGGATGTTATCTGCAGCGATGGGACTTTAGCTTCAGATGCTGGA
GCCGAGCTGCACAATGCGCGGGTAGCACGGCAGCGTGAGGAAGTCCACCATGTCGTCGCCAGTCAGCACCTTACCCATGATCTCGCCACCGAGCGCCCAC
TTGTTCCCAGGGGTGGCCTTCAGCGAGCGCTTGTTAACACACTCCTTGAGGATGTCCAGCACCAGATCCTTGGTCACCGTCTTACCCTCCACGGTCTTGC
AGCTGTGGCGGATCCACTGCCACACCTGGGCACGCGAGATCTCGGCCGTAGCGGCGTCCTCCATCTTGTTGTGGAGTGGAATGCAGCCGCTGCCACGCAG
CCACGCCTCCGTGTACACGAGGGAGACATCAATGTTCTCTACCAGGCCGTTGTATGTAATGGGGCCAGTCGGGGGCTCAATGAGCTGAGCAGCAGTGATG
TCCTTGCCAGCCTCGGGAATGAACGAGATCTGGTTCGGGCCCGACATCTTGCTGAAAGCATCCATGGCGATCTTGACAAGGCCAGGGTGTGCCACCCACG
TGCCGTCGTGGCCCGCAGCAACCTCACGTGACTTGTCCTCAGTAACAGCAGCCATGAACTTGTTGTTAAGCTCCGGGTCGTTCTTGACAGGAATCTGAGC
AGCCATGCCGCCCATAGCGTGGGCACCACGACGGTGGCACGTGCGCACGAGCAGCTTCACGTAGGAAGCCATGAAGGGCGTGGTCATACCAACTGACGAA
CGGTCAGGAACCACAAACTTGGCGTGGTTACGGAACTTCTTGATGTACGAGAAGATGTAGTCCCAGCGGCCGCAGTTGAGGCCGGACGAGTGGTTGCGCA
GCTCGTACAGGATCTCGTCCATCTGGAAGACAGCCACGATGGTCTCCACGAGCACCGTCGCACGGACAGAGCCCTGGGGAATGTTCAGGTAGCCCTGAGC
AGCCACGAACACGTCGTTCCACAACTTGGCCTCCAGGTGGTGCTCAAGCTTGGGCAGGTAGTAGTACGGGCCCGAGCCTCGCGCTAGCAGTTCGTGGGCG
TTGTGGAAGAAGTACAGGCCGAAGTCGAAGAGCGAGCCCGACATGATCTGGTTGTTCACGAGCACATGGGCTTCATCCAGGTGCCAGCCACGCGGGCGCA
CCAACAGCGTGGCGATCTTGTCGTTGAGTGCGTACTTCTTCCCGGTTTGCGGGTGGGTATACGAGATGGTCTTGCGCGCGGCGTCGATGAGGTTCACCTG
GCCGTCCACCTGGTTGAACCACGTGGGGGCCGTCGAGTCCTCGAAGTCGGCCATGTAGCACTTCGAGCCCGAGTTGAGCGCGTTAATCACCATTTTGCGG
TCCACGGGGCCCGTGATCTCGACACGACGGTCGGCGAGGTCGGCGGGATGGGGGCCACCTTCCAGTCGCCCTCGCGGATGTACCGGGTCTCGGGCAAGAA
GTCGGGCAACACGCCAGCGTCGAGCTCCTTCTGGCGCTGCACGCGCGCGGCAACAACGCCTGGCGCCGCGGCTCGAACTGCTCATGCAGGAAGGCGAGGA
AGCGCAGCGCGTCCGGGGTCAGCACGCGGCGGAAGTCGTCCGAGACGTGGCCCAGCACGCGAACGTTGGCGGCGTTGACGTTGAGCTCCGACATGGCGGT
TGGTTTCTGTTTGAGACTGCTGGAGATGGTCGATGTGTCCCTCGGAGGCAAATTGCGGAATGGCTCCAGGAGCCGATCCTGAGGCGACGTCTGAGCCGAT
GCCGACGTGAAGACGCAATGTCTTCAACGTGCAGTTTTGGCCAATGAGGTCGCGTCGTTTCCTGCTAGGTCCACCATACAAAAGCCAAGTCAAACGACGA
GGGACCATCACTCTTCCTTGCGTCTTGTTAAAACTGAAGTTGACGTGTCTTGCATTTCGTGCGATGCAGCAGCAGGTTTTGCCGGGTGTGATCAAGTTGA
TTGGACGGGTACTTTCTCTGCATGGGCCGGTGCATGGGAAGTTCCCATTGGAGGCACCTCGTCCTCGATCGCGAAGTGACGCCGCCGTGTCCTCGCATTG
AATGCTAAATAGTCTTGTGCCTTCAGGAACGAACTCGTGGATGTGCTTGTACCGCCAGACCATTTCGGTTGTACGGTGCGGATGGTGCGCTGCAACTTCA
ACGTGTTTGTCCAAGTACATCGCACAACCGCTTGCGTCAAGAACAAACGTTTTTGGTTATCAATTGCGTTGAAGGGGCCTGGCAGTCCAGCTATCTCAGA
AGAATCTCCATCTTCTGTCGATAAAAGCGTTTTACGAGTGCGGTACAACTGAATGCCCGATGCCATTACCAAAATGTTTCCTTGGCGAAGGGCCTTGTAT
TCATCAACTGTTCACAGCGAAAAAACATTAAGCTTTATGCGGCAGTGTGCAGAAAGCAACACCAGGAGATGTTGCTGGACATCCACCAAAGTGGGCGTCC
ATATGGAAAAAAAATTGGCGACCCCATTTTTTTCAAGTGTTGATACCCACGTTTCGCCTTGCATTTCATAGGGTTTCAAGTGCAGGCGGCGCCAGATGCC
TCTTTAAAACTTCAACGAGTTTCCTAATCGTTGCGTCTAAACTAACTAAATCACGCCGGAGGTGAGCCCATAATTTCTCTTGGCTGACGGCGTCTTCGGC
CTCGTTGAGAGGTGACGCTGTACTGCGGTCGCCTCCGAGAAGCTTTTGGAGAGGTCGATCGCCAGTCCCAGTGGCACGACATTCTTGGCCTCTTCGATGA
GGAAAATCACGGTGCTGAAAGACGGCCGCTGGATCGGGTCGGGGTCCCAGCACGCCTTCATGATTCGGTGCAGGATCTCTGGGATGTGTGGCAAAAGCTC
GGGGCGTAGATCCTCGTGTGCAACGAGGTAAGCGAGGTTGATGGCGTCCTTGTCCAGGTATGGCTTCTTAAAGCAGAAGAGTTCCCTTGTGGCACGACAC
ATTTCATTAGAATGAAGATCGTATCACAGAGGTGACTGCAGATTCTGTGTACCATAGCACGATGCCGTAGGAGTAGACGTCGATCTTTTCCGAATAGTCC
TCCCCGCGAAATACTTCCGGTGCCAACCACCGAGGAGTGCCGCACATAGTCTGCGCGTTGGTGTTCTTGTCGAGGCTGCGTGAAAGGCCAAAGTCGCTCA
GCTTGCACCGAAAGTCTTCCGTGATCAGTAGATTTTCTCCCTACGAAGACAAACGAGAACCAAAGTTATAGCCAATATTCAGCCAGCAAATGCAACCGTG
TTTTACCTTGATATCGCGGTGAAGCACGGCTGGACTAAGCGCGTGAAGATAGGCACACGCTTTCGCACAGTCCATCGCAATTTCGAGTGTGAGACCCATG
TGATGTTGAGCTGCTTGCTCCGAGCGAGCTGTAGCAGGTCGGCCAGAGATCCAGCGCATAGCTCTGTGAGGAGACAAAGCGTGGGTGGCTCGAGCACTGC
ACCTAGGAACATCACGATGTTGGGGTGCTGCAGAATGGAGAGAATGGACAGCTCGTTCTTAAAGTCCTGAACGGTTTTGGCAGAGTATCGCTGGGCAAGT
AATCGTTTGAGAGCGACGTGTTTGCCTTTGTAGAACGCCTTGTACACTACACCAAACGTCCCCGTGCCAATCTGACTCTCGATCTCGATCTCATCGAAAG
GAATCTTGAGTCCAAAGAAGACCGAGTTGTCGATGCGTCTCGAGTCTGTGATCGGGTTCACGCGGTGCTTCTTCTTCGACAATGCAACGTAAACGAGGGT
GCCAGCTTGTGTGGTTGACTGGAAGTGGTGCGTCAAGGGTGACACCGTCACAGGTTCGCGCGAGAACATGCTACCCATATCATAGGGAGTTGCCCAGAGC
TTGCAAGTGATCGTTAGTCGTTGGATCAACGCTGAGCGAGGAAGAACAGCTCGCAGGCCTGACGCGCGTGAACCAAACAAGGAAGATGCTTTCTATTTGC
AGTAGAGGATATTTTCATCCAGACGGCAAAGAAACTATCGTTCCGATGTCACCGTATTTGGTAGGTATGAATGAGTATGAGGTGGGCTTCTTGTGCAAGT
CAGTCGTGAATTACGAATTGCATTATGAACGAGCTTAAGCTAAAGAAAAGTGTGGAACTACTGCTTGCAAGGTTGGAACACGCTCGTCTGGATTAGGGAG
GAGCACAACATGCTTTTCAGTGGAAAAGGTTTCACACGTCTCTGATAACACCGGGCTCACCAACATTCGAAGTGACCAGCACGCTGGCGCGATTCTCGTC
GTCGGGGCTGACCTTCTCCTTGCATGGTGATTTAGTGTCACCACCCGCTAGACTTCCGATTGTTTGTTTGATGCCGAATGCTGCCAACCCCACGGCAGCG
ATGGCGCCGACACACGCTACCCCGCCAATAGACCAGTTGACCGCTGTGCTCTTGTGCGGGTCGAGATCTTCGGAGCTTGGTCCCCTCTCTTCGGCAGAAA
TGGCACGGGGCACTCCGCCTGAAAGACTGGTGCTGCTTCCTTCATCTGAGGGAGTGCTGTCTGTACCGGATAGGTCATAAGCCACGCTGCTGCTGTTCAC
AATCGCACAGTATTCCAGATACTCAGAGGTGTTTGTAGGGAACCTCATGCAGTACCGGCAGCCTGCGTCGCCGATGCAGCCTGACGCCAGGCCCTCTGGG
CAGTGAGTAGTATCGAGAACGACGCCAATGCCTCCTTCCGCTTGACCATCAGCCAACGACACATCTGCACATACATCATCCACTTCCGATGTAAATTCCG
TCGACTCGTGCAGTGCTACAATCGTGTCCGCAGAGATGGTCTCGTGTGTGTCCCCGATGAAGGGGATCGTCTTGAAGTTGATGTCAGCGCCGTTGTCGGA
GGAGGGAATATCGGAACAATTCATGTACGAGTGTGACTGGGTTGTCTCGAATCGCTTGCAAAAACGGCAGGTGCTATCCACACAACCAACGCCGCCATCA
CCACATCGGATATCGGTGACGATGTCCAAGCCAAGACTCTTGTCGCCATTAGACGCGGTTTGATAGCAATCTAGCGGAATTGAATAGTTGGATGTTGTAG
AGACTGGAGCAGTTGTCGGGGCGGCAGAACTCACAACAGGAGTGACAGTGGCAGTAGCGGAGGAAGTACTCGCAACAGGCGAGTAGTCCGAGCAGCTCCC
AAATGCGCCGATTGAACCGTCGATTTCGTCTTGCAAAGACGACAGACACTATCCATACAACCCAGTCCACCGTTTGTACAGCTCGCATCCGTGATGATGT
TGATTCCAACCGCGGCATCGCCATCCGCCACAGTTGACGTACAAACCTTGGTAGGGCTTGTGGTCGTGGGAGCGGTGGATGGACAGCTATTCAGATGCGC
TGCCTGGGTGGTATCCTGTGTCTTGCAATACCGACAAACAGTGTCGATGCATCCAGTGCCGCCACTTGAACAACTAGTGTCTGTTACAATGTTAATGCCG
ACAGCTGCATCGCCAGCGCTTACGGTCATGGCACAAGTGCTGGCAGAAGTTGCTTCAATACTTTCGTACGACGATTCCGTGTTGTCAGCAGACACATCAG
AGCTATCGGTGTCGTAGCTTGCATCTGTGCTTTCAGACGAATCCGTTGTGCTTCCAGAGGCGAGCCTTCGCGTCTGTGTCTCGGGATCGCTGACAACCGG
GATTGGTACGAAGTTGATGTCAGAGCCGACATCTGCGGACGGAATACTGGAGCAATTGAGGTACGCCTGCGACTGGATCGTATCAAATCGTTTGCAGAAG
CGGCACACATCATCCAAACAACCGGTTCCACCCTCGCTGCAGCTGATATCGGAGACGACATCCAGCCCAACTCCTTTGTCTCCACTTGAAACTGTGCGTG
AGCACTCGAAGACGATTGAAGGAGTACTGGAAGTTGCTGTCGTTGTGGGTGTCGGTGATGGCGTGGCTGTCGTTGTCGGGGTGATTGCTGTCGGAGCCTG
AGTACTCGTACCCGTGATTGTAGCACAATCCACGTAAGACGAGGATTGGGTAGTTGTCGTAAGTCTGCAAAAGCGACACGCAGCATCGATGCAGCCTAAG
CCGCCTGCCGCGCATGAAGTGTCCGTGACAATACTTATTCCTGCTGCCACATCACCCGCTGCCGCCGTAATGCTACAAACTGCAGTAGGAGTCGTTGGAG
CCGGCGTTGGAGTCACGGGAACGGTTGGTGCTGGCGTCTTAGTCGGAGCCGCTGTACTTGGTGCGGGTGTGACTGTCGGAGCTGCCGTGGTAGTTGGTGC
TGGCGTTTTAGTCGGAGCCGCTGTGCTTGGTGTGGGTGCGACTGTCGGAGCTGCCGTGGTAGTTGGTGCAGGTGTGATTGCCGTTCCTTCAATCGAGGCG
CAGTCCATGAACGGCGCGGACTGAGCGCTAGTCGTCACTCTGCAAAAGCGGCACACCTGATCAAGGCACCCCAAGCCTCCGTTGGCGCAACTAAAGTCGG
TGACGATCTTGATACCGACTGCTGCATCACCCTCCGACACTGTCTGGGTGCACGGCTGCTTTGTCGGTGTTGGTGCAGCGGTAGCTGGAACTGCGGTGAC
AGCTGTGGTCGGGCCGGAGTGGTGGTTATTGGAGCTTGCGTAGTCGAACCGGAGCCCCCAATCAAGGTACAGTCGACATAAGAAGCAGATTGAGTCGTCA
CGGTTGCTCGGCAAAATCGGCAGACATTGTCGATGCATCCCAGCCCACCCTGTGCACATGTCGTGTCCGTAACGATTTTGATGCCAACGGTGGCGTCCCC
TTCCGAAGCAACTTGGCTGCACAAGGGCGCGGCTGTAGTCGAGACAATGTTCGAGCAGTTCTGCAGGTACGCCGATTGGGGGGTTGATCTTGCTCGGCAA
AGACGGCAGACGTTGTCCAGACATCCAAGGCCGCCGTCCACACAGGTCGCATCGCTCATGATGTTAATGCCTACTGCGGCGTTACTCTCAGATACCGTCG
TTGTGCAAACCTTAACCGTGGCAGGGCAAGCGTCCAAGTGTGCAGACTGCGTCGTGTTTGTGGCTCTGCAGAAACGGCAAACGCTGTCAATGCACCCGGT
GCCTCCACTGGCGCAGCTCGTGTCCGTCACGACACTGATACCAACCGCTACGTCGCCATCCGTCGCTGTCAAGTTGCACACAATAGCAGAGCCCGCCTCA
AAGGCAACGTCTTCATGCAAGCCAGGTGAACCACTTGTCGAGATGGAAGACTCGGAAGGTTAGCGTCACTAGTGACTACGATCGGCACGAGATCAACACC
CCCTGCATCGCTGTTGGTACTAGACCCTGAGGTACTGCTTTGGCCTTCGACCCACGGGCACGACACAAACTGGGACGACTGGGAAGTTGACTCAGTCTGG
CAAATCTGCAGTGATCATTAAAGCAGCCGATGCCTCCATACAGACAGGAGGATCTGGCATGGCGCCTACACCAACTGCAGCATCACCACTCGAAACACCA
CACGAACCAGTCGAGATCGTTAAAGGCGCCATAGTCGGAAATGAAGTGCCAAGTGACTCACAACTCTCAAGGTGCGCCGACTTTAATGTGTCCACCACTT
TGCAGTATCGGCAGTCGTTACTGTAGCAGCCAAGGCCACCATCGGCGCACGTGAGATCAGTGATCACTTGAATGCCGAACGCTTTATCACCATCTGAAAC
AGCGCAGATTTCCAACACTTTCTCTCCTACGGACCCGGACGCCGAATTGGACTGCGCGCGAATCGTCGGGGTGCTGAAAGCCAAAGCACATATTGCGGCA
ATCTGTACGACGGAGCGCAACCCCACGCCTGGAGAATACACCATGGCAGCCTCGAATTGAATTACTGTTTGACTTTTGTCTTCACACTCGGACTGTGGTC
TTCGCACCGCGTTCAAGAATGGTTTGGGGTGTGTGGGGAGGATGCCAAGGAAAGGGTCATGGGATCAAGCTACGAGTGATCGGTTTCGAGCACCAAAGTG
CCTGGAATGCCTGCTTCCCATGTTATCAATGCCATGCCCACTCTTCGCTTACGGCCTCACGCCAATTGCCGTTGAGGAACTAGCACTGAACATTTTCTTC
ATGCGAAGCCACAACCGTTGTCACCATTAGTGCACTTAGGTCTTCGTTTCATCATCTATTTTTGGGTGGAAGCGAATGGGGTGTTTGCTCGTACGCGATC
GAGCAGGAAAATATAGTTGTCACACTCATGAACGTTCCTCCGTTGGAGCAAGCACCATTGACCAATTCGATTGACTACTATGTTACGTTGCAGGCTGGTG
GAAGTACTGTTCGATTAGTTAGGTATCCCCTCGGGACTATAATATGTTTCATGCATGTGCTCTTTCAGTATCATAGCCGGCATGGCATAGGAGGGTTCCC
GTTTTGGTGCTTGGAAGCGCGGAGGGCCAACGTGCAAAAATCACAGAGATGTGATGCAATAAAAGTCCGTCGTACAACAAATGTGAAACACGCTGATGAC
TTCCTGCTGTGGCAACCTACCGTATCACCCGTTGCAATACCGCAGAACAGGGCACGTGACGATACCTCTCGGCATTCTTTTGTGTACGCATGCCGCAGAG
AAAGAGGACGGGCCTATTAGGCCGCTCGCCGCCGCTGGTGGCGCGCAGTTTGCTTGCACTTGTCGCCTCTGAGCAATCGAGTCCAATCGATAGCGCGGTG
AATCTGTCTGCCTCCGGGGCCAGACATACACACCAATAGCGCTTGGACTGCTCGCCACAAGTCAGTCTCAGTTTGAGCACTCTTGCCGGAATGGTCTGGG
CAGAAATGCTTTGAAGTGTGGACGGACAGGGCGAATCTCGTTCGCTAGCTTTTGAGCGGATAGGCCCATTGAAGTCTGCGGCTCGCACCACGCGAATCTT
CGCGTCAAAAATGGCCCGACGACTTTTACAGGCGAGAGGCTGTTGCTCGGCGAGACTTGCTGGTACAAGCTTGCGTTTGGGCGGCACAAAACTTCATCCG
TACGCGAGTGCAGTGCGTGGGAAACTCTTGTCACCCAATTGCAGCTAATAAAGGGAGGATTTCCGCTCAAAATCAACTGTGAAGGTGGTATGATACAGTA
TTGGCCGTGATTTTGAAATGTAGGTGCACATGCTTAGCATTCACAAATGCTAAGCACGCTAGCAACCTGGAAACCAACACACTCGCCCAACGGAAATGAA
AGCGTAAATCGAGCGACCGCCTATCGTTTCATGTACTTACCTAAGGTAATAGGAAGGGAAGTAACCTTCATGGTGGGGCAGGGTGTGGGGAATTGTAAAC
ACGAACGAGAGCGAGGGCACGAACAAGAGAGCCCACGCCTTCTCGACGACAAGTTCTCAAACAAGCGTGCCATTATTCGCGACTAGGTGCAACTTTGATT
CTGTCCTCAACTTCGCACCACTGCCCCGAACGACTTGGGGCGATCAATAGCTGAACATGCGCTTTCGATCTGGCGGGCACGCGTCCAGCGTTTTGTCGAT
GGCAAGCTTTTTCGCGTTGGTCGAATCTCGCACCGATTTCCCGTACACTTGTTTTGAGTATTCGTCGAATCTCCGAATCTTGATGGGGCTTTTCCCTTGC
AGTCAACAATTTACAGCAAAGTTTCAAAAGCGGGTGGATTGGTCATCAAGACGACAGTAAAAATTTGCACACATACCTGGTTTTGAGACAGTGCCGAAGG
AACTCACCTGATGTTCAGTTCCTGCAAATTGTAATTGCCGCCAACATGAATCTCAACATTGAAGCACACGGCGGAAAATCGAGTTGACACCTGCATATGG
CTGGGTTTTCGGGCATGAACACGATATTACGGCGTTTCGGAATCTCCGCCGTTCCCTCGCGCTGGTATCGTTGGCGACACGGCGCTCATCACTTTCCATT
CCCGCGCCAGATCGTCAATTCCCGCGACCATGAAGTTCGGCAAAGGCCTGCTGCAGGAAATCCTCCAGAGCAACCCGGAGTGGGCGCCCTTCTGGCTCAA
CTACAAAATCCTCAAGAAGCGCATTAAGGCCGTGACCCGCGCGGCCCACCATGCCGCCAACCAGCGCGACATTTGTAAGTGCTTTCGTTTCCGGGGTTCC
AGACAATCCGGATAAGTTGCTCATCGAAATGTTTGCGCCCAACAGCCGAATCGGAGCTGGAAGTAGCCTTCTTTCGCGACCTGCAGGTCGAGCTCAAGAA
GATCTCGCTCTTCTACGCCGCGGAGGAGAAACGCTGCTCCTTCCGCTATCACCAGCTGCGTTCCGTGCTCAAAACCCTCAAGGTTTGTAGCTAACATGTT
TTGCGGTTTAAGACACACCAATTCTGACGTGGGTTTCATCAGAAACGAGAGCAGATCGAGGCGTTCGAAGCTCAGCGTCTCATGTTCGCCTTCGTGCACT
TTTACCGAGAGTGCATCCGTCTCGAGAACTTTGCCGTCATTAACTACCAGGGATTTTCCAAGGTGAGGCCAAAACGTGTTGTACCGTGTCTTTAAGAGGA
CATCCTATTTAACCGTACTGGTGACGACCTGGCCATGCAGATCTTGAAGAAGCACGACAAAATGACGGGCTACAACACGCGCTCCAAGTACATGCGCCGC
AAGGTAAACCTGTCATCTTTCTCGAGCTACCCGACTCTGCTGCAGATCTTGGCCAGCACTGAGGACATGTTCCACGAGGTGGAGCGCGACACCCGCATGT
CATCTGCCGTGTCCAGCATCAAGCTCAACATCGAACCACAGGTGGCGACGGACGCTGACAGCACCAACGTGTTTGCGCCGGTGGTGCATGTCCCGACTGA
GGCGGGAACATCGTCGACCCCAGTGGGGGCTAAGTCTTCGCCGTTGCCTCCCAAGTTCCTGTCCCCCCATCTCACGCCATCTAATTCATCGGCCCCTGCC
CCTTCATTCCCCGCCTCGGTGTTGTGGAATTCGGACGAGCAGGAGGCGGTTTTCCGCGCGTCGGCGCAGAAGTTCCAGCTCTAGCAAGTGCGATCCACGC
AATCATACCAACGTTTAATTTATCCACAGCAACAGGATTGAGTGCACGGCCTGCAACGATCACCGAATTGCACGAAGTAAGAACTAAAGTACCGACTGGC
GTTTTCATTTTGCAAGATCTTCTTGCACATGAATTAAAGTTTTCGATCTTACAACATCATGTTTACAAATAATTTTCGGCTCGACAATTTCACAATTAGC
CAACATTTCCCTTTCGAATCCGCATCCGACATAATGGCGCAGTTACTCCGAGCTGCAGGTCCGCTTGCTTCCTACGCTACAACCCCTTTCACCCAAACTA
ACCCGACACGATGTATAACAGCTAATGGCAACCTCGAGAAGGTGATCGAGTTGCGCAACGACTGGGCCTTCCAGAACAAGAAGGGCGAGTCCGGTATGAT
ACGTCCCGACACCAATCTACTTATTTTGCTTCAGTATGTGCTAAAATGTGTATTTCGTAATTGTTTTTATTATATTTTAGTGCTGCACGTGGCGGTGTCC
GAGGACCAATTGGAGATCGTGCAGCACTCGTGTCCAATGGTGCCATGCTCAACCTGCAGGAGAAGAAGCGCCACTTCACGCCCCTGATGCTGGCGTTGGC
CCAGCAGCCGCCCAGGTTTGAGGAGATTTTCCAGGCCTTGCTCAAGGGCAAGCCGGACCTGAGTGTGCAGGATGCCTCGGGTCAAACGGTGCTGCATTTG
GCGGCAGGTAAAAAGATGTTTTCGTAGAATTATGCTTTTACGTGGAGTTAAATCGTATGATGGCTATGCAGAGTATGAGGAAGTGGAGTCATTGAAGTTG
CTGCTGAAAGCAAAGGGGAAGGTGGATGCGGTCGACAGCAAGAAAATGACGGCGCTGCATGTGGCGGTCGCCAAGGGGAACCTCGAGATCGTCCAGCTGC
TGGTGGAGTCTGGCCGCGCTACTGTTAACGTGGTGGACGTCAAAGGCAACACCCCACTGTAGGTGCACGAGGGAAGCTAGCTATTGCCACCGTGGTGCTA
ATACTTATGCTGGTGTTGTAGGCACTGGGCATGTATCAAGAATGGCGGTGATCAACTGGAGCTCATCAGCTACTTGATCTCCAAGGTTCCTACTCTACAT
AGTAGTGGAATAACAGTTGCTGCCAACCAGGATCTCACCTTTCGTATTGATGTGTGCAGGGCGCGAAACCCCTTAAGAACGCTCATGGAAGCACACCTCT
GCACTCGGAGGCGATGCATTGTGACCCTACTGCAAATTGGCCTACTGCTGCTGCGGAGGTGCTGACTACTGCGTTTACGGATCTGATAGCCGAGGTCAGC
AACAACGGCCTGACTGCCCAGCAAACCTTTGA