Description :
From Genome Similarity Track
Location :
Scaffold_90:10323- 14425
Sequence
4102 bases(100 bases per row)
GGATCTCAATCCGACGATCCCTCTGTAGGATCTTTCGCGGAGTTGCGTATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGGGCTCCCCTTC
TCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACGCCATATTCTGCCATTCTCTGTAACGACGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATA
CCGTCCTTCGCCAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACTTGGTC
CCTGAATTACGGTAGGCACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTCAACCGATCTGGCAGTTCCCAGGTTTCTCCGGG
CTCGATCCAGGTCGTCTTATCCGCCCTTATGATCCTCATCTACGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCGGGGAAACAA
AGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCTGGTACCATGAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAACATCGAA
CCAGTATACCAAACAACCTGCCAGCCTGATCTTGATCCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTC
CCATCCACTTCGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCT
TGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCACGGGACTCTCCTGTTAGCAGATCCATGGATCCAACATCCTC
AGATACATAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACTTCACCCTTGGTAGGATCAAACCATCGATCATGTTGGCGTTTCTCTTAA
TAACCACGTGCCTCTCCTCTGTGTAGATCCAGGGTTATAGAGACTTCGGATCTGGAAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACA
CTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACG
CTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCATT
GGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACACCCCGCGACACACGTAGAAGCAATGATCTCCGGGATGAC
CTTTCTTGCCACACTTTCTCACAGACCAGATGTTTTCCAGCATCCCAGATTCAGTGTGCCTCCCGGAATCGCCACTGCGAACACCTGACCTGGGCTGTCC
CGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGACCGCGAGTTGTCTCCGGCCTTCGCCGTTCGATCGTTGGATGC
AGTGAGACAGACTCGACGGTAATCCTCAGGGTCGGAGTCCGAACCGTCAGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGA
GCTGGCGCATTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACTT
CTTCGAGCTCATCCGCGTCTGGAAGACGTAACAGGGTCAGCCTGTTGGCCAGATCCACATCTCCCAACGTCTCGATGAAGTGATCCACGTGTTCCCGCAG
TACCCTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTATTCGATGTAGGTATTCTAGCGGGGAATTAACTCGATCTGCGGCG
AGCATGGTAGTATTGTCGTGCCACCGACACTCTCAATCTCACAGTACTGGGTCTGGAAGCTGCGTCGGCAAATTCGGGCCACTTGTTCCTGGGTGGAATC
TGCCCCAGCTGCCGATACCAGTTTCCTGGCTGGCCCCCGCTAGCCAGATTCGCCAAAAGGGTCAAACACTTCTCAGCATCCCGACGCTTGATCTCTCATG
AGGGCCGACTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCCGATATGGCTGAGATCCGTACCC
TCTGGATCATGGACGATCCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAAGTGGATGGGCCGTCCAGATCATCTGGGTCGAACTCATCA
TGGGAGTTGTCTCCCTCCACGGACTCCATCTCCCACGTCTCGAGCTCCATGTTCGGGAGCACTGCACTGGTGGCACGGGCTTTTACATACCCCTGTTGCG
GCGAGAAAACGAATCCTGGCAAATTGGAGAGTTTCCTCGCGAGGTGCCCCGAGGAAGGTTTCGAAAATAGCCCGGGGGGCTGTTGGGCCCCCCGGGCGAG
ACCCGGATTCCCGGAGAGGGTATTACCTTGACCCCGAAACAGAAGAATATTCCCACGGGCTTCTGCCGGATTTGGGCTAGTTTCCGGGGGGGAGGGGTGT
TTCAGAATCACCGCGTAGGGCGTACTGGATCCCGAGCCTTCACGTTCACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCC
GGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGAATCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGC
GACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCT
CGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAAAAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGT
TGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCGGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGA
TACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCG
TTTTCGTCTTCTTTCTCGTTTCTTTGACTAGCGGGGTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCAC
TTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAAATTCGCAGGGGTCCCCGAGGGGACCTGAGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGA
TCCGGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTATTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCC
GACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGTGAAATCCCGAGTCACCAAAAACTCCGGGCACGCGCACCATTGT
GGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCTGGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGCAGGGGGCCCCCCTATGATCCGTGCT
CTGCTGAACTTTCCTCACCTTGTGTACCCGTCAGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGG
CGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAACCTTCACTCTGCGTCCGTGGATGTTTCTGGATCCCAAGCGAATATTCGAGCTTATGGATCCAGG
GCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTCCCTTGCCTTTGCGTTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTT
GA