Description :
From Genome Similarity Track
Location :
Scaffold_81:103218- 105701
Transcript NameFunction/comments
Phyca_LT1534555995Avh339
Phyca_LT1534129176conserved unknown protein

Sequence
2483 bases(100 bases per row)
aagcctcagtgacttgaaagcatcccgtggcttcattttgtcactcacccacgtttgcaaaagtgccgtctccaagtccgttaagagcttggacattggg
acacgtccgagcatctttgcgatcacttcatccccgtagtgcttggtcaacacagagatcactgtcgtctgttgtttatcaggcttctgctggttcaacg
tgttcgtgaacttggtgaacgtggtgaatagagggtttgctagcagtttctccccctcttggtccagcttcagcagcacaaagacgtcatccactgactt
gccactggccatccaacgctgaaattgctcggattgaagccttttagccactgtagacgagctcttggtcttcagagctgattcaacagtcctagacatt
ccactgacgccgtaccttgtggtcaaaatggacaacacactcgctctctcttgtacttaagaagtaggtccttgttgtaaaggttcaggtacgaattcca
atacgcgaactgagggcttgtgcaaattcgtaggattatcttgagcgaagaccttccggtagttgttccaggcgtcaaacacgggactggcaagcagtga
atcatctacttgatcgagttttagaatggtgaaaatatcatcagcggatttgccactggacaaccacttttgtatctgggcagcctccaatttggtcgca
atagcctccgttccgtccactttctttgctgcttggatcatcttcgtcagagcttcagttccaaaatgcgccgttaaagtcgagatcgcggaggtctccg
tgtttggattcttcttaacgaaatcgtccgtgtacgtcaaccaagtagcaaactgaggattgtccaggattttatcacttgctttattcagctgcagcct
cgcgaagacatcgtcgacagattttcccttgtttaaccagttcgcgagcttctctggggtgacgttgggtcgaagagcagccgtggcctttttaatgaca
gactctgcaagccccgctctctgttcatcaaaaaggtcttcagtatccactgacgtccgtaggatcctcgtggatgagtctgttggcactgacaaagctt
gggcttgtaccagcaggacaactgcagctaggaagacgatatccctcacagtcatgagtggatgagagaaaaagatacaatgaagtggatacgacaattt
cataccggaatatcttggcgatggggtagcgtcttctacttcgaagtattggtgaggagacagcgatgaagggggataatctttcttaccgattgccaga
aaaataatcgagaagaatgattacagactcctgcaggaaaaaaacaacaacacaacaatgataaaagagttccatttagattggagaatagttcatccac
tggaagccagcgaaaacccacggaattgcatctatcggcgtggagcaattctcatgggtttaccaccgttcgcgttgggtccagagagacccatttcttc
cagaaacttgtccattctcgcattctccttcgcctagaagcagtaaaaccacacttaagaacacgccaagagtctgcaaacactcacattgcactatacc
ttcagtccggccaatttctcctcctgctcttccagtttccgacgtcgtgctgaatcacgttgagccattctccgcttcaactcgtcatcacctcgtccac
ccatgaggaaatcctcactcagatcgagaccgtcacgtgcgtcttctcggtctcttgcagctccgtgcagtttgtcccctagttgacgtcgtttctcaat
ttgtgcttcccttccagtaggtttcggggccagttcatccatcaccacgtcgcggtactcccgttcctttcgacggtctattttccgtctctttctgtcc
tgttccctgtcgtcttcatcttgaaaacgacgtctagccttgtcctcatcgagtactggccccttgatcttctccttcccagaagtcaacaaattgtcct
tcttggtcgccacatccaccgagtctttggctgttgccagctcaaatttctccttttctccgagtttcgccacaaaaccccaccggtgacgcgtcctttt
ggtctgttccactaccgaatcgggaattccttcgtaaaacatcgacgataacttgcctcggttccatttcctggcgaattcatgggtgaatagctccgta
gcttcgtctgttgacagatcatcgacatatttgttcctacatttacaagggttaattcaaagtaattagaacaataaaatccacatctaaaattacgtac
ttggtttgtgccagccagacacggaactcagtctgacgcagaaaatagtcctcatctgtgatctttttcacgcctttgggcaattttgagtcgtgcgatt
tgtggcctttgtggcgggacgagcgctcgtcatctctgcggctggacttgcggctggaggaggatttcctcgagcgcttcctc