Description :
From Genome Similarity Track
Location :
contig_75:10321- 11658
Transcript NameFunction/comments
g12323.t1hypothetical protein

Sequence
1337 bases(100 bases per row)
CCCGCAAACACGAAGCGTGCCCGGGAAAACGCATCGCGCACCTTTCTCAAGTTCCTGGCAGACGAGGAGGTTGCCCGGGACAACCTAGAGACGTGCATGA
AGCGCGACAACGCTGCACAAGTGCTGGAGGCAGTGGTGGCACTATCTTGCTTTCAAGGAGGGCCGCAAGGGCCAGCTACTCGCTCGTCACTCCGTTATGC
AGTACTTCAGGCAAGCCAAGAACAGGCTGTTGGAACAGGTCCCTCAGCATCGAGCCTTGGTTGACAAGAACCTGCTCAAGAAGGGCCTGATGCTGGAGCG
TCATTGTGTAAAGCGCGAGACGGGGGCGTTTGTGAAGAAGGCTCCGGCATGCACGAAGACGGCGCTCAAGAAAATGATGGAGTACCTGTATTCGACGGCG
GTTACTGCTGCTGACTCCCAAGACGCGGCGGTGGCGGCGTTGATGTGATTCCTATTCGGGCGCGCATCGGATCTTACCATGCTTCGAAAGGCAAACTTGT
CTGTTGGCTCGGGCAAGATCTTCTTCGCCCGCTTCATCCGCATCAAGACATCGGAAGAGCAAGGTCTGTCGCTCTTTCCCGACGATGACTTCACCACGTG
TCCGCTGCTCGCTATAGCGGTTGCTCTTGCGACTCAGACAGCGCCGACCATTTCCGTGTTGAGCCAGCTTCCTGAGCAGACGAAAGTTTCCCAAGCTTCT
CTGTCTTCATCCATTCCACTCATCGACCTTCTGGATCACCCACAAGCCGTTACTCCTCCCCAAGATTCGGCTGGCGAAGCTGGCGATGGTACGAGTACTG
ATGCCGCGCCTGGTGTGCACAGATACGTCAACCGCGTCCTTGATCGGATTGCAGAGAAGGCAGGTGTCGTCGAGCAATTGACATCGCATTCCTTCCGCCG
TGGAGGGGCGCAGCACGCGAACGGAGCCGGCTTGCGTGCCCAGTGGAGGCGCTTGGAACATGACGGCGACGAACAAGGCATTCGCGTACGTCTTCAATAC
ACCGGCCGAAGATCACCAGGTGGCTCGCGTCTTGAGTGGTCGCGACCCGGACCAAGAACTTCACGTTCTCTCGCTCGATGTCTTTGACTCAGCTACGTAG
ACGAAAATCCACATGATAGCGGTGGCTCTCTTCAACGCGTCCTACGGGCTCATGGCATCACAGTACAACGTGAACGGTATTGTACTCGACACGTTCATGG
TTTACCTGCTGCGCCACTATCCCTCGTTGAAGAAGCTCAATGAGAACGGCCTTCCTGTGGAGCGCCTGGAAGCATGCACGATCCAGCAAGGCCATTCCGT
CAACGAGCTCCTAGCTTGGTCATCACACCTGACCTGC