Description :
From Genome Similarity Track
Location :
Scaffold_9:1032094- 1036588
Sequence
4494 bases(100 bases per row)
TAGCCTACTATAGATATACTCAGCTTACAACCTACCTTAAATTGGTCACCTCGCTCCCTTTTGGTAAAAGGAACCTGTGAACTGCCGTTTACCGAGCGTG
TGTATACTCTCGGAACCCAACTTCCTCTAGCGCAAGGTGCTATGTAACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCAACGCGGGTAGACT
ACCTGAACCTCTCTGAAGATCGTTTCCATGAATAAGAACGACTTCTTCCATCTGAACGAGTCATAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCG
GGATGGAGGCCCTGCAGAGCCTGGTGGCGTCAACACCGGCCGAGCAGCTCGAGCGCGTCAATGCGTTCGACGCTTACAAGCAGGGACTCATCGCGCATTT
GCGGGAAAACCTGCAGGGTCCGGCGGCGGAGACAACTCCGCCACACCCCAAGCCAATACGACTGAAGGTTAAGCCATAGGAAGGGAAGGAAGGTGAGAAC
CTTCACGTCTGGGTCCGAGAGGCAGAGCTCGCGATGGACGCAGCTCTGATCTCGACCAAGCAACCTCGTGTTGCTTTTGCACTCTCCAACTTTAGCGGTC
GTGCTAAGCGTTGGGTGTACACGCGGGAGGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAGCAGCTACGAGCTGCGTTCCTCCCGGC
GAACTACGAGTACTGCCAGCGCTCGCGCCCCTCTCGTACAAGCAAGGGAGGCGTGAGCTGCACGAGTACGTCCAAGAGATACGGGAGCTCACGGCGTCCC
TAGTGGGAAACCCACTGAGCGAACACATCAAGATGACTGTGCTCATGGACGGCCTTCGCGTGGGCCCAGCGCGCGCTCAGCTGTTCCGGGTGCAGTCAAG
CACCCTTGAAGAGGCGATTCAAGTGGCTTCAGGAAGAATACAGCCATCGCCAGGCGCGTAGGCCAGCGTCAGTATGGTCTGGGAGTTCTTTGTCGACTCC
AGGCCGAGCGAGCCCCAACGGACCAGTTCGCATGGAGCTCGGGTCCGCCGAGCAGCGCGACTGCCCCACGGAAAGCCTCCGCAGACGGACTTTCTCAAAG
CCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCCGGGACAGGGGAACGCGGGAAACCAGTAGGGGCGGGGTACCCTACTGGGGAAGAACTAAGTGG
TGCGCGGGTGGCGCGTACCACGGGGACTTAATCCCTGAGAGTCTTCGTACTCTCGAAACGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTG
TACGGGGATATGATCACCCCTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGAATTTTGCACGCCGCCAGACGGTTGCTCGTAATAGCAACAAGTTGTC
CGATGCTTTGAGAGAAAGCAAAGGCAACGGGACGGTGTCGGCACGACTGGCGGACAAGAAGGTCGTCACTGTCCCCGACGTCCAAGTGGATTTGGCTGTC
AAGTTTGAAGACTTTGACAGCCTCGAACGGCTCACTGTTCTCTTCATGGATCCCTACGATAGGAGCCTGGGCATGCCCTGGCTTGACGAGTACGAGCCCT
GGATCGCCTGGCGAGGCAAGGCAATCGGTTCCAGTCACCCTACGAAGTCCGACAGAGCATTAATGAGTCATTCTCCCACCTCTGTCATGACTCGGGGCGC
CCGCAAGGGTTGCCAGGGTACCGAAGAATCCAACAAATGCTTGGGGGGCGTCGACGTATATGACGACTCCGAGAACGCTTCGATGGTGGCAGCGCCCAGA
GGAGGCGCTGGCCAAGTGGATAACTGAGGTCCACAAGCGGGTAACATTGCTCCGCAGACAGCTGCAGCTGCCACGAGCGCTGGTAATAGCGTGTTCAAGG
TGGGTAGCATAGTGCCTCACGCGGTCGCCCAGACCTTAACCGAAGGGGCAGACGTCGGATACGCTCCCTGTGTGGGTAACACAGAACCACACGAGGCCTC
TAGTGCCTCGGGTGTCGGCACTCCGACATCTCCAGACGTGGGTAACAAAGTTCCACGTCACGGTCGCCGTCGAAGACAAAGCCGCCGCCGCCGCCGAAAG
TCGGATCTGAACCTCGTTCAGATCGATGTCGCTTCAAGCCACTCGGAGTCCAGGGCACGGGCTCCTCTGACAAGGCCGGTGGAAGAGTGTTATCACATCT
TCGATGGCGAGGCCGGTTTACCCGTCAAGGCATCTGGTGTGAACTTGGAACCATTGCCAGATGTTGCAGAGATATTGAACCTCGAGGAAATGGCGGTCGA
GGTTTTCCTAGCCAACCACAAGGCTGGGAAGGTTGCCGAGATGGTACTCATAAGACCTGAGACCACTCGGGAGGAGTTAAACCCATCCTCTGTCTTGGAC
GAGGGCGTCCTGGACGAGCTGAACAAGCAGCGTCAGACGCGCTTGGGTTCTGATATGGTTAGGAACCCCACGGATCCGGTGTATTCTTTGGTGACGGAGT
ATGCGGACGTGGTAAACAAACACCCACCGATCCAACTCCCACCAGATCGAGGCGTAAGGCATGAGATCGATCGCGATCTCGTGTCTGGCACAAGTTACTG
TGTAGTTCGTGCTTATAACAAGCTGAACAACGCGACGGTGCCGGCCCAAACACCTCCCATGGAAGGATATGTTGTTGAACAACATGGCCGGAAGCGTACT
GTACAGTGCGCTGGATTTGGTAGTCGGATACTACCAGATCCTGATGCGAGAAAGCGACATCCCGCTCACCGCGGTGAGCAAGCCAAACGGCATGCTTTTG
AGTAGCTCGTCATGCCGCAGGGCTTTTCTAATGCCCCGGCGACATTCAACCGCCTGGTGACGCAATTGTTCAGGCCGCTACGTGCCTTCGTACAGACGTA
CTTCGACGAGAGCTTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGTCATGGAGGTGCATCTGGGCACCTCCGCCGAGTGGACGTGACGCGAGCGAACA
CGCACTACGCCAACATCGACAAGTGCGTCTTCGCGTCACCAGATATTAAGGCTCTCGTTTGCTTCGTAAGCAATGTGGGAGTTGGTGCTGTCCTCGACAA
GGTCAATGCCATGGCAGCATGTCCAGCGACTAGATCCCAGAAGGATCTTCAAAAATGGTTGGGCTTGGCCAACTACCTTCACTAGTACAGCGCAAGGTAC
GCGGGCTTCGCTAAGCTCTTGTCGGGTCTCCTTCAGAAGGGCGCCGACTGGCGCTGGGAGCAGGAGCGCCAGGATGTCTTTGACAGCATCGAGAACAGTC
TCTAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTACCGTCGTCTGCGATGCCTCCGACTATGACATAGGTTGTACACTGCCGCAGGT
CGACACGGCTGGACATGAACGAGTCATCGCGTTCCAGTCCAGACAGATCAAAGCCGCCGAGCGGCAAGGAGCTCCAGGCAATGCAGTATGCCCCTGTGAA
GTTTCTGGTTCACCTTCTGGGCTCTCGGCCCTTCGCGATCTACACAGACCACGGCATCCTTGAGGACGGCGACAAATTCGCCTTACCTCTCCCAACGGAT
GGCAAGGTGGCTGTCCTTCTTTGTGGAGTACGACTTTCACGTCGAGTACAAGCCGGGCAAGCTCAACGTGCTTGAGGACGCTCTCTCTCGGCGTCCAGAC
TACGAGTTTCCCACATCACACGAGTGACAACGGATCTATATGATCGGATTCGCATGGCGTATCGGGACGATGAGGCTGTGGCACCTATCGTTAAGTTTCG
CACGGCAGGAACGAGCGCGAAGTCCGACTGGCTTTCATCGCGACAGAGCCCCTGGCTCCACCGATATGATTTGAAGGATGGCCTTCTCTTTTACCCGGTG
GAGCCCAATGAACCTCTACGGGTGGTCGTACCCAACGACGAGGATCTGAAGCTCTACATCCTCGCGGAGGCGCACGACGCGCCCTCCTGCGGCCACTTGG
GCCGCGTGGAGACCTCCCTGTCGGTCTCTCAGACCTTCTGGCGGACCCACATGTACAAGTGGGTCGCCCGATATGTGAAGACGTGTGAAACATGTCAGCG
TGACAAACCCGCAGGGCGCTCTTCGGGTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCC
GCCGACGGACACGGCAACACGGGGATTTTGGTGTTCGTGTGTCGGCCGAGCAAGATGATACATCTCGCTCCAGTGCCCGTTACCGTCACGGGCGAACAAA
CCGCGAGGTTGGCCCGCGGCTCGCGGCTGCGTTTTGAAAAACGCTGGTTCCCTAAATGGAAACACGTCTGCCTATGTTCACTGCGGACCACCCACAGACA
GACGGTCAGCCAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGTGCAGTGTGTGCGAGGAAGCGCCACGTACGTGTTCGACGCAGCTTCCTG