Description :
From Genome Similarity Track
Location :
scaffold_60:103206- 105394
Sequence
2188 bases(100 bases per row)
GGCAAAAGATGTCCGCCATGAGGCAAGCTTAGCTTTGATGGGATGGGCCGGATCAACACGATTGTTGATGGGACACCAACAAAAGAAACATGGTGTTTCA
TGTAGATTTTCTTGTCTCATTTTTGGTTGAAACGGAGGAAACGTCAAAGAGTTCTAGAACCGTTCTTTGCCGTTTAGGCGAGGAATGTTTTACTATTGTT
GGTTCGCTAACTTGATCGCATCATTGTTGCTCGAAAAGCTAGCTGCCCTAAAGGTCTGCGAAAGTATATATGAGATTACTGTTGACTTTCCGAGGGGATG
ATGTACTAGGTAAGACTGACAACGTTCCCTCACGTTCGAGAAGGCCAACCAAAGTGCTGTTATGGTACTCTATAAAAGACGATGACGCAAATCTTCGTCA
TTTGAAACATCGAATCTCGCTGTATCCCTGCGTTCAACTGCATAGTACAACAATCCATTGTGTACTCCAAAACGGTGAACACGCGAACTTGTGCGAGACG
GAAGATCTTGCAGTGTTTTGTCGGAAGCGTCCTTGAATTACCCCAACAAgtcctgacatgtctcatcaAGCTTATACAATTTATTCGCGCACTATAATCG
TTGCTTGCACTCTGATTGTCTGAACATCTTTGCAATATCAACATGACTCGAGCATGATTTCGCTCCTGGACTTTGGATCATAATCCGGATgtcttgacaa
cgcatctgCTAAGATGTTCGTCTTGCCTGGCTTGAGTGACATCAAAGTTGTACTCCGCAAAGTAGGGAGCCACCGACCTTTTTCTGTGATAAATAAGGAG
TCTTTACTGCCGTACGCTGtgaggcatgatctgtatagattgCGAAGCGTTTCACTACAAGCAAGTACACACGGAGCCTATCCAAAGCATACTTCACTGC
tagaagctctttgtcacGAACTGGACAGTTCCATTCCACGGGCTAGTGTTGTCGCGATTGATTCGAAACAACTCGCTCTCGGCCCTCATCGCAGTGTCGC
GTCAATTTACAACCGATGGCATAATCACTTGCATCACAGAACCTATAAAAAGGCTCATCGTGGTTTGCAATTGCAAGGAGAAGAGCTTTTTTTCAAGCtc
ttcacttcggcaaatatCGCCTGGTGACCATCTGACCATTCCGACGTTTTCTTAAGGAAGACAGTCAGGGGCGGCACCAGCGCTGCATAACTGCGCGTGT
ATGTGTGCAAATAGTCGGCAAAGCCCAACCATTGTCTCAACTGTTTCACGTTGGCAGAAAATCATTGATGACTTTGACTCTCTCCGGATCTAGAGGAAAG
ACATTCATCCCCCATATAGCAGCCAAGAATGTGGATGTCAGGTgcaaaaaaagattttcaGGTTAGCTTTGAGTTCATTGTCCCGCATATCGTGGAAGAC
TTGACaaagatgatcaagatgaacttCGACATCAGACTTCTCACTCGTTTTCTTACTATATACGAATAAATCGTCAAGTAGCTCGGTGCAAACTCTTTCA
ATGGATTGAGAAAATTCGTGACCATTCTGGTGAAAGTGGCGGGAGCGTTGTTCAAACCTTGTTNNNNNNNNNNTCCCTCATATACTGGAGGATCCTTCTT
CTTGTGCTCGACTCTTGATGCAACGAGAAATTCAAACCGTTTATTGGCTTGTTGCATCTGGGCTTGCATCTGAGCTTGCATCTGAGCTTGATATTGCTGC
NNNNNNNNNNCAccgtacgccaatgcagacaaatgcatctttggcgcagaagagattcccttttttagggtgcttcattgggaagcgaggccttcgagcg
gatcccgctaatgtcaaggccattgtagactggccgatcccaaagaaccagaaagatttgcgtaagtggcttggtctcgccaacttcttgcacaagtaca
gcgtaatcTACGCAGAAATAgtccggccattatccaatctccttaaaaaggatgcgaaatggtgttggaacaccgaacatcaggaagcttttgacggggt
caaaaacTGCCTcatgcatgcaccaatactggtgctACCAGACcgtgatcgtcctttcagcgtcgtctgtgacgcttcgagctttgccatcggctgcgca
ctgctgcaagcagacgccgaggggcgagatcgggtgattgcgATCGATAAAGTTGCAGAGAAGCGATCGATATcgttgcagagaagaa