Description :
From Genome Similarity Track
Location :
Scaffold_481:1032- 5361
Transcript NameFunction/comments
Phyag_g6058conserved hypothetical protein
Phyag_g6059hypothetical protein PHYSODRAFT_309120

Sequence
4329 bases(100 bases per row)
CATTGACAGGGACAGCcgaactgcaacaacacGACGCGAAATTTGTTGCTGTCCGTCAGCCCGCTCGGCTCAGCTCAGCGATGAGGGCGGACCAAGGTGT
CGGCGATGAACATTATGCGGGCGCGACGGGCGCCGCTATTAAAATGGCGGCGTTGTGGCCTGCATTGGTATAGTCGGAACTTGCCACGAAACGGTTTTAT
CTGCACGACCCCGTCGTCGCCAGCAACGATCTCAGTAGTGCaggtgtgctgctgccgaggGCCAAATTCGAGCGTGCACGTACGGGCGGATATTCCCTAT
GCGCGACATCGTGGGACCCGTCCCATGCGTAGTTGCCGCGGTCGACGTCGTCTGCTCCACCGAGCTTCCGATCTCGATCCCGAGCCTCGCGATTTTCGAC
CGCAAGTGCAAGCTGGCTGCGGCACTTCAGTGAATAGTTCAGTCAATGCAGTCAGTCCCCCGCCTGTCAGCTTTGGCCGATTCGGTCGCGACATATCCTG
TTCCGCATCGGATTCAAAGCGCTAGTGCTGGAGCACGGATTTTCCGCCTCCTGCTGGTTATCAATTCAATGTGCACCGCCGTTTCATTCAACATCGGTTG
CGTGTCCGGCATCGCAGCGTGGTTCAGTAGCACTTGACGCCTATCGAAAGGGCTGCACTAACGCCGTGTGTGCCTGGACAACGACAACCACGAGCGACTT
GTGTCAGCGCCCGAGCCCTGTGCACTCGAAACCATACAAGCCCCAGATGGTTGCACgctttggcgctggcgtAACTCTGTCGTGAGGCGCAAACGGTGCA
CGGGCTCGGATATCGCACATCCAGCCAGAGCGCGGCGCCACACTATCCAGCGTCCGCACGTGCCGACTGCGGCAGTCGGTATTTGCAGCCAACCGCCCCA
CGTCGGTCATCTCtccggagacgacgacgtacaCACACAACGCTCGCTTGCAGTCGCCATCCAGCCTGCTCTGCACGTTGCACCATACCCCGCATTGCGG
CGCCTGTCCAAGCGGAGGAATCAAGCGAGTCAACGACCAGCGGAGCCCGAGCTCAGCGCCATTTAGCGTTGGGTACTTTGTAGCGTAGCGTAGGACGACC
GACTACCATGAGTATGTTCCAGAGCGGAGTGCAGGTGTTCATCCCGGCGGCGCTGAATCGACCCACGCACACGCTCTACAGCATCTGTATGCTGGTGCAG
CCCACCAACCAGGAATGGACAGTCAACCGCCGCTACTcgcagttcctgcagctgcgcaaGGACATCCAGCACAAACTCGCCACGCGCGGCGTCTCATGCG
CCAACTGCGCCAGTTTTAACCGTGCCATCAGCAAGTTCCGGTTCCCgagcaagtcgctgctgcggacCAATTCGGTGGTGCGTCATCGAGTTTCAGCACT
GCAGGacttcctcaagctgcttgTGGGACGCGTATACAACGACCTCCCCAAGTGCGGCATCTGcggcgaggagatcaaggacaTGATGAGGCCGTTCCTC
ATCCGAGGAGCTCAGCCCATGAACGGCTCAATTATTTCCAAGATTAAcaagtcgctgtcgctcgATTCGTACGCAATCGTGGACCAGCCAGTGATGCCGG
TACCAGAACCGGATCCGGCGCCGCCCATTTCGCCCTCGTTGGCAGGCAAGGAGCTGttcagcgccagcaagtcGTCCAGCAAACCCATTTTCACACATAG
TCAGGTTTCAGGCGGCAAGTCCATCTTCGCGATGATGAGTACCAGGTCGGACGATGCTTCCACCGTGCCGAACGAATCGGAAGACCCTATCATGGATTTC
GAGTACTCGGagagcgatgacgacggctACGGTAAAAAGTACGACGATCAACGTTGCTACGACGAGGGCGTCCCTCTTGAGGAGGCGATGAAACAGGTCG
TGGTGCCCAAGGGAGCCCGACTTACCTGTGAAGAAGTGGTTGTCCGACTCACGTCGATGTGGGCTGCGTACGACCTGGATGAGGCACTCTCATCCTTGCC
ACCCGAGCGACTTTCACAGCAAGCCAAtttctcggtggacgagaaggaatACGCGTTTTGAGGTGTTGTTGGATAGTGCAATTTTGCTTTTTCCACCTTT
AGGGGTATCTGCTAGCCGGCCAATAGAGCCGCATCGCCCCACGGGTAGGGTGGTGTGCAAACTAAGTATGAAGCAGTCAGTATAATATCAATGCGATCAG
CACATGGGTTATCAATGTCATTGATTCAATGATAACTTATCATGGTCATGATAATTTGTCACTCACAAAAAGAATGACTCATCGGACTTCATTTTCGTGA
ATACACTCGTTGCGTTTGGCTGGATGCACCTCTTACTCGCTCACAATTTGGTTTCTATAACTTGTCGGGGTCGGCGATACCAGTGGCAACCACGGAAACA
CGCAGTTTACCGTCGAGAGAGTCGTCAAACGTCGACCCGAAGATAATGTTGGCGTGCGGGTCGTCGAGTTCTCGTGTCAcacgctctgctgcttcgtcaa
cTTCGAACAGCGTCAGATCGGAACCACCCGTGATGTTTACAATCATGCCCTTGGCGTCCTGCACGTCAAgaaaattaaaaaaaaagtGCGTATGACGAGC
ATGGCAATCTTGCAATAGGGTTGTCTCTCTACCTTGATTGAAATATCTCCCAGGAGAGGGTTCGCCAGtgcatcttcagcagctcgtaaAGCCCTACAAG
ACGAGCACGTGAACTTTAGTCGACCCAACGCCATTTCGTAAACcgctcaacagcaacagacaaGCGCACCTGTTTTCTCCATCAGCCTCTCCACTTCCCA
TCATGGCATTTCCCATGTTTTGCATCACCTGCAGTTTCGAATTGTAAACAGAGAGTGAATTGGTTGTCATTAAGTTTACCACTGAGCAACCAGATAGTTT
TGCGTACCGACTGGACGTCCGCGAAGTCGAGGTTAATGAGCCCGGGCATCACCATCAAGTCAGATATGTTTTTCACGCCGTCAAGAAGCACATTGTCCGC
CATTCTAAGATCAGAACAATTGCAATCGTTAGAGACGCCCCGATAAAACACGAAGCACCGTCACAATCTGAAGAAGTATACACGCACCGGAATGCATCCA
TCAACGAGGTACGCTCGTTTGACATATTGAACAAATTCTGGTTCGGGATAACAAGCATCGTATCCACGCTGTCCTTCAGCTCAACCAGGCCTTGTGCCGC
AAGCTTTGCGCGGTTGTTTCCTTCAAATCGGAATGGCTACAACGAACATGAAATGCAACACGGTAAGCGCTACATGATCAAGTGCCACGATATATTCTGC
AGCGTACATACCTTGGTGACCACGGCTACTGTTAGGATCCCGGCATCAAGAGCTGCCTGGGCAATGACGGGTGCTGCGCCGGTGCCAGTTCCACCTCCCA
TGCCTGCAGTAACAAACATCTACACAGACAAGCGGACCTGTTAGCGCTGCACACTTCCGTTTAATCGGTACGAAAGGTAGCGAACGCACCATGTTTGCGC
CCTGAACGCGCTCCAGAATCTCGTCAATTGCcgcctctgctgcttcgcgaCTAAATCACCACAGCACCGAATTAATTAGCAAACCTGTTAGATGCTCCCC
GCTATCCCATACCACGAAACCATACTTACCCAACTTCAGGGTTGGCGCCACAACCCAATCCTCCAGTTAACTCCGGGGCCATCTGAACACGGTTCTCGGT
TAACGTCGTGCGCAAGTGCTGAGCGTCTGTGTTGCAAACCAGGAACTCCACGCCCTGCAGGCCGCGCGCGATCATGTTGTTCACTGCCAATGAATTCCAT
CACGACACCAATCAGCTCAATTCCCTCCAACCTGCCAATGCACTCGTCACTCAATCCCACACACCTGCGtttccaccagctcctccaacaccaacgacCA
CGATTTTCGGCGCAAAGCCTGACAAGTCCGTCACGGGGTGGTCCTGCGTGAGCCACAATGGCTGCGTGGAGCTCATCACGGGcggcacgagcttcttctc
caccggAGGCGGCGGCACTTCGCTCACATCCATCGGTGACGCAGGTTCCGCTTCCATCTCCACTTGGAGCGCTTCAGCGTCGTCCTTCTGAGCCTTCTTG
AAGCCCTGTAAACAACGTCACGTGAAGACAAAATGTCAGAGCTGTGTTTGGGAACAGTTTTATTGGAATTGACTGGCACTTTACCATGCGCAgagctgcg
gctgcagcgtcagtAGCTTCAGTAGAGAAGGCAAAGCGCTGGGTGGCGGCTTGGGACACCTGACGGGCGCgaagcagcgccgacgccgtGGACTTCATGC
GGGAAAGCACCATCGGGACCTGGATCGCC