Description :
From Genome Similarity Track
Location :
Scaffold_3218:1032- 2838
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3218-snap-gene-0.1Respiratory burst oxidase

Sequence
1806 bases(100 bases per row)
GACACGCAGATCGGGTGCCTCGTCGCGTACTTTGCGCTCATGATCTTGGTGTTCAACCTCAAGGCCATGATGTTTAATGTTGATCCAGCCGTGGGCTACT
GTCCGAAGATCGCCAAAGGCTGCGCACAGGTGATCATGGTCAACACACTCTGCGTGCTCATGCCCATGTGCCGCAACTTTGTGACGTCGCTGCGTAGCCT
GCCGATCGTGGTCAGGTTCGTGCCGATCGACAAGCACATCGAGTTCCACAAGATCTGCGGCGTCGTGATGATCATCGCGTCGCTGGGCCACGCGGCGGCG
TGGATCATGATCGTTTACTACGCGCGTACCGTGCCTCTGTCCGTGTGGGCCAAGTCGAAGTACTTCCACCTCTCCTTTGTGCGCGACGAGAACCTGTTCA
TGTTCGCGCAGCGGATCCCAGTCTGGACAGGTCTCCTCATGGTCGTGCTCATGGCCATCGCGGCGCCGCTGACGCACTCGAAGATACGTCGCGGCAACTT
CAACGCGTTCTGGCTTACGCACCTGCTCTTCCTGCCCTTCATCCTGCTGATTGCGGTCCACGGCCTCGCGATGTGGGTGGCCCAGCCCGAGGCATTCGTG
TGGATCGTGCCGCCCCTCGTGATCTACTTCATCGAAAAGCGCTACCGCATGGGCAACGTCTTTGGCGGCAAGACGATCATCCTGGACGCCAAGCTCTCGA
AGGAGGCCTGCGCGCTGTTCATCAAGAAGCCGGCGTCCTTCGGCAAGGGCCAGAAGTTCCAGCCAGGCATGTACATGTTCATCAACATCCCTATGATCTC
GCAGTTCGAGTGGCACCCGTTCACGATCTCGTCGGCGCCGGACGATGCGTTCCTGAGCCTGCACATCCGCAAGGCGGGCGACTGGACCGGCGCGCTCTAC
AACACGGTCAAGAAGATCCAAGAGAAGAACCCGTCGAGCCTCGACATGGAGGGCCACGGCGCCGAGAACATGTCGCCGTACCCGACGATCTTCATCGACG
GGCCCGTGGGCGCGCCGGCGCAGGACTACACGCGGTACCGCGAGGTGGTGTTTGTCGGCGCGGGCATCGGCGTGACGCCCTTCGCGTCCATCCTGCGCAA
CATCTTCTACCAGTGGGAGAGCTTCAAGTGCCCCAACTGCTCGCACATGCGCTTCCCGCCGACGTTCCAGATCCGCAAGATCTACTTCTACTGGACCACG
CGTGAGCAGGAGGCGCTCACGTGGTTCACCGAGACGATGAACCAGCTGAGCGAGATGGACACGGAGAACCGGCTGGAGATCCACAACTACTACTCGTCCA
TCAAGGACGAGAAGGTCATCGAACCGCTCCAGGCGCTGCAGAAGTTCATCCACAACACGGAGGGGCAGGACATCGTCTCGGGACTCACGACCAAGCAGAT
GACGCACTTCGGGCGGCCCAACTGGAAGGGTGAGTTCGCGCGCATCGCGGAGAACCACGAGCGCCTCGAGCGCGTCGTGCCCATCGGCGAGAAGGAGGAG
ATCGGCGTCTTCTTCTGCGGCCCCAAGCCGCTCGCCAACACGCTCCACGAGGAGTGCACGAGCTTCAACCAGGACAAGAAGCGCCGCGCCAAGGACCTCG
AGTTCGACTTCCACAGCGAAAACTTCTAGGCAGGCAAGCATCGGAGGGAAGCAAGCAAGCGATCCAGCACGTGCAGATAGATACCCGCAATAGTCGTCCA
CCTGTGTCTTTGTATGTCCATCAAGAGAGTGCGGCGCGGATATTTATTAAAGTGAAACGAAATCGCGTACATACTTAGCTTCCCCAGGTGAACATTGAGC
TCCTGA